Forum

Nome Utente:
Password:
Riconoscimi automaticamente
 Tutti i Forum
 Laboratorio
 Biologia Molecolare
 mRNA si, Proteina no
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'è:

Aggiungi Tag Aggiungi i tag

Quanto è utile/interessante questa discussione:

Autore Discussione  

farmacologia
Nuovo Arrivato

Ignorante


100 Messaggi

Inserito il - 16 marzo 2009 : 22:02:25  Mostra Profilo  Visita l'Homepage di farmacologia Invia a farmacologia un Messaggio Privato  Rispondi Quotando
Vorrei confrontarmi con voi su un aspetto che non mi è molto chiaro. Partendo da RNA,retrotrascrivendo ed amplificando ottengo delle bande che mi inducono a pensare ad una elevata produzione di mRNA di mio interesse. al WB non evidenzio l'espressione della proteina.
cosa può essere successo?
Io ho qualche idea.
1. Le cellule sono i podociti e trattandosi di cellule in uno stadio immaturo (tipo pro eritroblasti, pro mielociti, ecc.) queste trascrivono il gene ed in uno stadio successivo traducono l’mRNA in proteina, per cui, nel momento in cui finisco i trattamenti e le sacrifico per purificare RNA e proteine, queste ultime non sono ancora disponibili, anche in virtù del fatto che sono di membrana.
2. Esiste un sistema di RNA interference che degrada l’mRNA per cui non si porta a compimento la traduzione.
3. Possibili splicing alternativi producono una proteina non detectabile con il mio Ab primario.
Sono idee plausibili?
E come fare per confermarle?
Se avete qualche altra idea, possiamo discuterne?
grazie.

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 16 marzo 2009 : 23:03:42  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Scusa ma innanzitutto perchè i tuoi podociti sono in uno stadio immaturo?
Sono cellule immortalizzate nello stadio indifferenziato?

Sul primo caso avrei dei dubbi, ma non sapendo bene che tipo di cellule stai usando e che trattamenti fai, non saprei.

Per il secondo caso se avessi degradazione dell'RNA non lo vedresti! Al massimo ci può essere un meccanismo legato ad un miRNA che inibisce la traduzione. Ma sui miRNA nei podociti è stato pubblicato ancora poco, ne hanno individuati 3 per ora.

Per il terzo caso, se si tratta di splicing alternativo questo lo vedi nell'mRNA, quindi basta sequenziare l'mRNA.

Hai provato un solo anticorpo contro quella proteina?
Hai fatto sia immuno che western blot?
Sei sicuro che l'anticorpo funzioni? Hai qualche controllo? Hai provato anche da glomeruli isolati?

Se sono proteine di membrana poi, non sempre i podociti in coltura le esprimono.
Ma se le tue sono cellule immortalizzate qua parte un lungo discorso di chi abbia la "vera" linea di podociti e qua le discussioni tra i vari gruppi sono molte!!!

Comunque se vuoi facciamo cambio, io ho visto in svariati modi la proteina e ho dati funzionali sulla sua inibizione, ho knockato il gene e vedo gli effetti... ma non trovo sto cavolo di RNA!!!
Torna all'inizio della Pagina

farmacologia
Nuovo Arrivato

Ignorante



100 Messaggi

Inserito il - 18 marzo 2009 : 06:54:00  Mostra Profilo  Visita l'Homepage di farmacologia Invia a farmacologia un Messaggio Privato  Rispondi Quotando
grazie gfpina.
si le cellule sono trattate con sv40. me le ha mandate il collega finlandese con il quale collaboro, l'anticorpo che utilizzo funziona perché ho dei positivi consolidati che utilizzo sempre come controllo +.
vorrei provare con l'immuno-isto per cercare qualche segnale nelle cellule.
vorrei provare a seq l'rna, ma non ho mai sequenziato. a proposito, secondo te, i primer di innesco li devo scegliere, non sapendo se c'è splicing, tali da vedere tutto il mio rRNA? o devo prendere più porzioni di dimensioni più piccole? mi potresti aiutare nella decisione? Hai qualche protocollo?
Relativamente poi alla non espressione delle proteine di membrana nei podociti, sapresti indicarmi la fonte di tale affermazione?
Per il tuo rna, qualche dritta poso dartela io. Casualmente mi è capitata tra le mani (me l’ha prestata un collega)la superscript vilo dell’invitrogen e con questa sono riuscito a retro trascrivere titoli molto piccoli di rna, non titolabili dal mio strumento. Se puoi prova e fammi sapere
grazie di nuovo
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 18 marzo 2009 : 07:28:15  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Ma dai vuoi vedere che vengono proprio da qua!!!

Per il sequenziamento se riesci ad amplificare tutto l'mRNA sarebbe meglio, ma non ho idea di quanto sia grande, così innanzitutto vedresti anche la dimensione.
Poi il sequenziamento puoi farlo anche a vari pezzi, utilizzando magari delle porzioni sovrapposte.
Non so se sono stata abbastanza chiara... ma sono un po' di corsa.

Per il mio RNA ti ringrazio, ma non è una questione di "quantità" penso la motivazione sia un altra, ma ci sto lavorando!!!

Torna all'inizio della Pagina

Patrizio
Moderatore

mago

Città: Vancouver


1900 Messaggi

Inserito il - 18 marzo 2009 : 10:45:26  Mostra Profilo  Visita l'Homepage di Patrizio  Clicca per vedere l'indirizzo MSN di Patrizio Invia a Patrizio un Messaggio Privato  Rispondi Quotando
hahahah che storia GFPina,vuoi vedere che state nel laboratorio accanto ...


Torna all'inizio della Pagina

farmacologia
Nuovo Arrivato

Ignorante



100 Messaggi

Inserito il - 18 marzo 2009 : 21:44:25  Mostra Profilo  Visita l'Homepage di farmacologia Invia a farmacologia un Messaggio Privato  Rispondi Quotando
magari ragazzi. in finlandia o in qualche altro paese (anche a quel paese).
comunque non sono il collega "della porta accanto".


ho scoperto le faccine
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 19 marzo 2009 : 19:48:53  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Citazione:
Messaggio inserito da farmacologia

Relativamente poi alla non espressione delle proteine di membrana nei podociti, sapresti indicarmi la fonte di tale affermazione?

Esperienza personale!
Sopratutto il mio capo finlandese è convinto che alcune proteine di membrana, quelle importanti per formare lo slit diaphragm non siano espresse da podociti in coltura e se gli dimostri che ci sono ti dice "non sono podociti!!!" La teoria è che sono proteine che necessarie per formare determinate strutture e venendo meno queste strutture nelle cellule in coltura queste proteine non vengono espresse.

Citazione:
Messaggio inserito da farmacologia

comunque non sono il collega "della porta accanto".

Di sicuro perché qua di Italiani oltre a me non ce ne sono!!!
Dicevo solo le cellule vengono da queste parti, ma in realtà penso vengano da un altra città non da Helsinki!
Torna all'inizio della Pagina

farmacologia
Nuovo Arrivato

Ignorante



100 Messaggi

Inserito il - 19 marzo 2009 : 21:22:11  Mostra Profilo  Visita l'Homepage di farmacologia Invia a farmacologia un Messaggio Privato  Rispondi Quotando
e di conseguenza esiste un meccanismo endogeno che controlla l'economia cellulare, nel senso che mancando le strutture costinge la cellula a non spendere energie per qualche cosa di inutile. potrebbero essere i mirna.
a giorni mi attiverò per implementarei il sequenziamento del mrna per verificare gli splicing alternativi.
ti terrò informata.
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 19 marzo 2009 : 21:35:51  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Citazione:
Messaggio inserito da farmacologia

e di conseguenza esiste un meccanismo endogeno che controlla l'economia cellulare, nel senso che mancando le strutture costinge la cellula a non spendere energie per qualche cosa di inutile. potrebbero essere i mirna.
a giorni mi attiverò per implementarei il sequenziamento del mrna per verificare gli splicing alternativi.
ti terrò informata.

Beh tieni presente che la struttura in realtà è molto complessa, esistono vari tipi di cellule, soprattutto è importante l'interazione tra podociti e endotelio. Vengono scambiati segnali che regolano anche la produzione di proteine. In coltura manca tutto questo.
I miRNA potrebbero rientrare in questo meccanismo, ma tutto parte dai segnali che si scambiano le cellule i miRNA poi rispondono diversamente a questi segnali e possono impedire o favorire la traduzione di proteine, ma non credo sia l'unico meccanismo.

Torna all'inizio della Pagina

farmacologia
Nuovo Arrivato

Ignorante



100 Messaggi

Inserito il - 24 marzo 2009 : 21:17:28  Mostra Profilo  Visita l'Homepage di farmacologia Invia a farmacologia un Messaggio Privato  Rispondi Quotando
Cara gfpina, rieccomi
come ti avevo anticipato non ho alcuna esperienza sul sequenziamento, per cui ti chiedo una mano, se ti è possibile, poiché non ho nessuno con cui confrontarmi per sgombrare i mille dubbi che mi attanagliano.
Poiché vorrei sequenziale l’mRNA, purificato dai podociti, in particolare quello per la proteina di membrana p75 (avente due spicing alternativi), vorrei conoscere l’approccio tecnico per l’identificazione dei primer che mi diano la certezza di trovarmi nel mio mRNA e in particolare quale spicing predomina e quale p75 viene espresso.
Questi primer serviranno per retrotrascrivere, per cui in effetti sequenzierò i cDNA?
Non sono in gamba ad interagire con NCBI per cui, non avendo mai navigato "seriamente" per ricercare primer e quant'altro mi trovo in enormi difficoltà.
Scusa se non mi esprimo in termini altamente tecnici, ma le deficienze su questo argomento sono tante.
Tieni in alta considerazione il fatto che sono medico e nel campo della ricerca mi inchino ai biologi ed ai biotecnologi, non per essere un p.c. ma perchè è giusto che a ognuno il suo.
grazie se vorrai darmi una mano e per avermi letto fino in fondo
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 24 marzo 2009 : 21:29:54  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Ok ti prometto che ci darò un occhiata! Non stasera che devo ahimè ancora finire un report!
Comunque sei medico... magari potresti essermi utile per risolvere altri dubbi!!!
Torna all'inizio della Pagina

farmacologia
Nuovo Arrivato

Ignorante



100 Messaggi

Inserito il - 24 marzo 2009 : 21:46:12  Mostra Profilo  Visita l'Homepage di farmacologia Invia a farmacologia un Messaggio Privato  Rispondi Quotando
proposta accettata. chiaramente se di mia pertinenza.
buona continuazione
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 25 marzo 2009 : 18:34:42  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Citazione:
Messaggio inserito da farmacologia

proposta accettata. chiaramente se di mia pertinenza.
buona continuazione

Beh ovviamente! Sarebbero nel caso domande più cliniche ma sempre sull'argomento!

Comunque scusa un attimo facciamo un passo indietro, visto che esiste un'elevata omologia tra questo recettore ed altri recettori, sei "sicurissimo" che i primers riconoscano specificatamente il tuo mRNA?
Hai mai fatto un blast? Puoi anche testarli con il nuovo tool di disegno dei primers di NCBI Primer Blast, basta che inserisci la sequenza dei tuoi primers e li fai cercare.

Poi domanda che non ti ho ancora fatto, i podociti sono quelli umani vero?
Nel qual caso la tua sequenza sarebbe questa: http://www.ncbi.nlm.nih.gov/nuccore/161377414

Hai letto tutta la letteratura al riguardo? Pare che comunque questo recettore sia espresso nei podociti solo allo stadio immmaturo.
Ad es vedi questo: Neurotrophin and neurotrophin receptors in human fetal kidney.
Torna all'inizio della Pagina

farmacologia
Nuovo Arrivato

Ignorante



100 Messaggi

Inserito il - 25 marzo 2009 : 22:23:40  Mostra Profilo  Visita l'Homepage di farmacologia Invia a farmacologia un Messaggio Privato  Rispondi Quotando
i podociti sono umani.
i primer li ho ricavati dalla letteratura.
le sequenze sono le seguenti:
5'CGT GTT CTC CTG CCA GGA CA3' fw
5'GAG ATG CCA CTG TCG CTG TG3' rev
e non ho fatto un blast. adesso ci provo.
ho avuto comunque un'altra idea che ti partecipo.
tenuto conto che gli esoni sono 6, trovando i primer giusti per ciascuno, potrei indagare la loro presenza o assenza nell'mRNA maturo.
e tanto per il seguente motivo
tieni conto che come ab ne utilizzo uno che riconosce l'epitopo da 1 a 160 del dominio extracellulare.
ti invio il PRODUCT ANALYSIS SHEET
http://tools.invitrogen.com/content/sfs/manuals/AHU0302_Rev%201.0.pdf
esistono due varianti di p75
l'isoforma 2 ha un N-terminale più breve , confrontata all'isoforma 1.
per cui con il mio ab non riesco a detectarla
e se fosse questa
ti invio i link delle due isoforme
http://www.ncbi.nlm.nih.gov/nuccore/156630994?ordinalpos=1&itool=EntrezSystem2.PEntrez.Sequence.Sequence_ResultsPanel.Sequence_RVDocSum
http://www.ncbi.nlm.nih.gov/nuccore/156630993?ordinalpos=1&itool=EntrezSystem2.PEntrez.Sequence.Sequence_ResultsPanel.Sequence_RVDocSum
In alternativa potrei acquistare l'ab che riconosca la proteina più breve, ma credo che come prima indagine, tra l'altro meno costosa, potrei indagare la presenza degli esoni per stabilire il clivaggio della regione N-terminale.
a te sembra sensato?
se si, mi dai una mano a disegnare i primer per gli esoni.
rimane sempre il discorso del sequenziamento per il quale ti ricordo l'aiuto.
sono imbarazzato per le continue richieste.
resto in attesa.
ciao
Torna all'inizio della Pagina

farmacologia
Nuovo Arrivato

Ignorante



100 Messaggi

Inserito il - 25 marzo 2009 : 22:32:52  Mostra Profilo  Visita l'Homepage di farmacologia Invia a farmacologia un Messaggio Privato  Rispondi Quotando
gfpina sei grande. ho fatto ciò che mi hai consigliato e guarda cosa è venuto.
grazie, grazie, grazie.
è la mia prima volta
Primer pair 1
Sequence (5'->3') Length Tm GC%
Forward primer CGTGTTCTCCTGCCAGGACA 20 64.77 60.00%
Reverse primer GAGATGCCACTGTCGCTGTG 20 63.08 60.00%

Products on intended target

Products on allowed transcript variants

Products on potentially unintended templates

Products on target templates

>NM_002507.2 Homo sapiens nerve growth factor receptor (TNFR superfamily, member 16) (NGFR), mRNA

product length = 522
Forward primer 1 CGTGTTCTCCTGCCAGGACA 20
Template 527 .................... 546

Reverse primer 1 GAGATGCCACTGTCGCTGTG 20
Template 1048 .................... 1029

Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 25 marzo 2009 : 22:55:58  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Allora
Primo: i primers sono specifici!
Secondo: io sapevo che p75 è un recettore più corto rispetto agli altri delle neurotrofine e manca di una buona parte del dominio citoplasmatico. A quanto ricordo.
Magari guarda qua: http://8e.devbio.com/article.php?id=143
se ha delle varianti di splicing non lo so sinceramente ma si può cercare
Terzo: le sequenze che mi hai mandato sono di NT3 che è una neurotrofina (uno dei sui ligandi!), non del recettore! La sequenza giusta è quella che ti ho indicato io!
Quarto: si potresti amplificare tutti gli esoni e vedere se ci sono tutti, dovresti anche vedere le giunzioni tra un esone e l'altro.
Ma sopratutto in caso di sequenziamento, avresti la possibilità di farlo? C'è un centro dove ti puoi appoggiare?
Torna all'inizio della Pagina

farmacologia
Nuovo Arrivato

Ignorante



100 Messaggi

Inserito il - 26 marzo 2009 : 07:02:23  Mostra Profilo  Visita l'Homepage di farmacologia Invia a farmacologia un Messaggio Privato  Rispondi Quotando
ciao.
da quanto ho capito p75 non è un recettore più piccolo rispetto agli altri delle NT.
E' la variant 2 che produce un prodotto più piccolo rispetto alla variant 1, manifestandosi sulla regione extracellulare N-terninale (ti ho mandato i link), per cui lìab che uso non la detecta.
non capisco poi perchè mi dici che le sequenze sono per NT3, quando nel report di primer blast viene riportato NM_002507.2 Homo sapiens nerve growth factor receptor (TNFR superfamily, member 16) (NGFR), mRNA che è proprio p75.http://www.ncbi.nlm.nih.gov/nuccore/161377414
per il sequenziamento ho preso contatti con BMR Genomics di Padova.
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 26 marzo 2009 : 10:04:30  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
No guarda che hai capito male!
Citazione:
Messaggio inserito da farmacologia

da quanto ho capito p75 non è un recettore più piccolo rispetto agli altri delle NT.

Si è così invece! p75 è il recettore a bassa affinità per le neurotrofine, le lega tutte ma a bassa affinità e manca di un dominio intracellulare. Se guardi il primo link che ti ho segnalato è spiegato!


Citazione:
Messaggio inserito da farmacologia

E' la variant 2 che produce un prodotto più piccolo rispetto alla variant 1, manifestandosi sulla regione extracellulare N-terninale (ti ho mandato i link), per cui lìab che uso non la detecta.
non capisco poi perchè mi dici che le sequenze sono per NT3

Perché le sequenze delle due varianti di slicing che hai segnalato tu sono per NT3!!!
Queste:
Citazione:
Messaggio inserito da farmacologia

ti invio i link delle due isoforme
http://www.ncbi.nlm.nih.gov/nuccore/156630994?ordinalpos=1&itool=EntrezSystem2.PEntrez.Sequence.Sequence_ResultsPanel.Sequence_RVDocSum
http://www.ncbi.nlm.nih.gov/nuccore/156630993?ordinalpos=1&itool=EntrezSystem2.PEntrez.Sequence.Sequence_ResultsPanel.Sequence_RVDocSum


sono le isoforme di NT3!!! Non di p75!

Citazione:
Messaggio inserito da farmacologia

ti invio i link delle due isoforme
http://www.ncbi.nlm.nih.gov/nuccore/156630994?ordinalpos=1&itool=EntrezSystem2.PEntrez.Sequence.Sequence_ResultsPanel.Sequence_RVDocSum
http://www.ncbi.nlm.nih.gov/nuccore/156630993?ordinalpos=1&itool=EntrezSystem2.PEntrez.Sequence.Sequence_ResultsPanel.Sequence_RVDocSum


Homo sapiens neurotrophin 3 (NTF3), transcript variant 1, mRNA
Homo sapiens neurotrophin 3 (NTF3), transcript variant 2, mRNA

Quella che ti ho inviato io e quella riconosciuta dai primer è la sequenza giusta del recettore p75.

Citazione:
Messaggio inserito da farmacologia

quando nel report di primer blast viene riportato NM_002507.2 Homo sapiens nerve growth factor receptor (TNFR superfamily, member 16) (NGFR), mRNA che è proprio p75. http://www.ncbi.nlm.nih.gov/nuccore/161377414

Infatti quello va benissimo ed è la sequenza giusta!!!

Non ho avuto tantissimo tempo per controllare, ma da quello che ho visto di p75 non sono riportate varianti di splicing! Almeno nel database di NCBI.

Citazione:
per il sequenziamento ho preso contatti con BMR Genomics di Padova.

Ok quello va benissimo, anche io le mandavo a loro!
Torna all'inizio della Pagina

farmacologia
Nuovo Arrivato

Ignorante



100 Messaggi

Inserito il - 27 marzo 2009 : 23:38:22  Mostra Profilo  Visita l'Homepage di farmacologia Invia a farmacologia un Messaggio Privato  Rispondi Quotando
hai ragione. scusa. sono le isoforme per NT3
p75 non ha isoforme.
grazie
Torna all'inizio della Pagina
  Discussione  

Quanto è utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-18 MolecularLab.it Torna all'inizio della Pagina