Forum

Nome Utente:
Password:
Riconoscimi automaticamente
 Tutti i Forum
 Laboratorio
 Tecniche
 PCR, primers
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'è:

Aggiungi Tag Aggiungi i tag

Quanto è utile/interessante questa discussione:

Autore Discussione  

nuna
Nuovo Arrivato




48 Messaggi

Inserito il - 19 gennaio 2010 : 21:00:37  Mostra Profilo  Visita l'Homepage di nuna Invia a nuna un Messaggio Privato  Rispondi Quotando
salve ragazzi,
in lab mi hanno dato delle sequenze da analizzare.
Sono per la PCR.
Mi hanno detto che sono primers foreward e reverse e la sequenza genica da amplificare.
Mi dareste delucidazioni?
Cosa sono i primers reverse e foreward? A che sequenza si appaiono?
Grazie

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 20 gennaio 2010 : 00:12:59  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
I primers sono gli "ineschi" che si attaccano alla sequenza da amplificare:
- primer forward (non foreward!) o "senso" ("sense" in Inglese) si attacca alla sequenza "non codificante" (è quindi uguale alla sequenza codificante per questo è detto senso)
- primer reverse o "antisenso" ("antisense" in Inglese) si attacca alla sequenza "codificante"

Esempio:
Sequenza
CCACCGCAGCGGACAGCGCCAAGTGAAGCCTCGCTTCCCCTCCGCGGCGACCAGGGCCCGAGCCGAGAGT
AGCAGTTGTAGCTACCCGCCCAGAAACTAGACACAATGTGCGACGAAGACGAGACCACCGCCCTCGTGTG
CGACAATGGCTCCGGCCTGGTGAAAGCCGGCTTCGCCGGGGATGACGCCCCTAGGGCCGTGTTCCCGTCC
ATCGTGGGCCGCCCCCGACACCAGGGCGTCATGGTCGGTATGGGTCAGAAAGATTCCTACGTGGGCGACG
AGGCTCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCACCAACTGGGA
TGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTTCGCGTGGCTCCCGAGGAGCACCCCACC
CTGCTCACCGAGGCCCCCCTCAATCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCT
TCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGG


a doppio filamento hai:

CCACCGCAGCGGACAGCGCCAAGTGAAGCCTCGCTTCCCCTCCGCGGCGACCAGGGCCCGAGCCGAGAGT
GGTGGCGTCGCCTGTCGCGGTTCACTTCGGAGCGAAGGGGAGGCGCCGCTGGTCCCGGGCTCGGCTCTCA

AGCAGTTGTAGCTACCCGCCCAGAAACTAGACACAATGTGCGACGAAGACGAGACCACCGCCCTCGTGTG
TCGTCAACATCGATGGGCGGGTCTTTGATCTGTGTTACACGCTGCTTCTGCTCTGGTGGCGGGAGCACAC

CGACAATGGCTCCGGCCTGGTGAAAGCCGGCTTCGCCGGGGATGACGCCCCTAGGGCCGTGTTCCCGTCC
GCTGTTACCGAGGCCGGACCACTTTCGGCCGAAGCGGCCCCTACTGCGGGGATCCCGGCACAAGGGCAGG

ATCGTGGGCCGCCCCCGACACCAGGGCGTCATGGTCGGTATGGGTCAGAAAGATTCCTACGTGGGCGACG
TAGCACCCGGCGGGGGCTGTGGTCCCGCAGTACCAGCCATACCCAGTCTTTCTAAGGATGCACCCGCTGC

AGGCTCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCACCAACTGGGA
TCCGAGTCTCGTTCTCTCCATAGGACTGGGACTTCATGGGATAGCTCGTGCCGTAGTAGTGGTTGACCCT

TGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTTCGCGTGGCTCCCGAGGAGCACCCCACC
ACTGTACCTCTTCTAGACCGTGGTGTGGAAGATGTTGCTCGAAGCGCACCGAGGGCTCCTCGTGGGGTGG

CTGCTCACCGAGGCCCCCCTCAATCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCT
GACGAGTGGCTCCGGGGGGAGTTAGGGTTCCGGTTGGCGCTCTTCTACTGGGTCTAGTACAAACTCTGGA

TCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGG
AGTTGCACGGGCGGTACATGCACCGGTAGGTCCGGCACGACAGGGAGATGCGGAGGCCGTCCTGGTGGCC


I primer saranno ad esempio quelli segnati:

CCACCGCAGCGGACAGCGCCAAGTGAAGCCTCGCTTCCCCTCCGCGGCGACCAGGGCCCGAGCCGAGAGT

CCACCGCAGCGGACAGCGC (primer forward)
GGTGGCGTCGCCTGTCGCGGTTCACTTCGGAGCGAAGGGGAGGCGCCGCTGGTCCCGGGCTCGGCTCTCA

AGCAGTTGTAGCTACCCGCCCAGAAACTAGACACAATGTGCGACGAAGACGAGACCACCGCCCTCGTGTG
TCGTCAACATCGATGGGCGGGTCTTTGATCTGTGTTACACGCTGCTTCTGCTCTGGTGGCGGGAGCACAC

CGACAATGGCTCCGGCCTGGTGAAAGCCGGCTTCGCCGGGGATGACGCCCCTAGGGCCGTGTTCCCGTCC
GCTGTTACCGAGGCCGGACCACTTTCGGCCGAAGCGGCCCCTACTGCGGGGATCCCGGCACAAGGGCAGG

ATCGTGGGCCGCCCCCGACACCAGGGCGTCATGGTCGGTATGGGTCAGAAAGATTCCTACGTGGGCGACG
TAGCACCCGGCGGGGGCTGTGGTCCCGCAGTACCAGCCATACCCAGTCTTTCTAAGGATGCACCCGCTGC

AGGCTCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCACCAACTGGGA
TCCGAGTCTCGTTCTCTCCATAGGACTGGGACTTCATGGGATAGCTCGTGCCGTAGTAGTGGTTGACCCT

TGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTTCGCGTGGCTCCCGAGGAGCACCCCACC
ACTGTACCTCTTCTAGACCGTGGTGTGGAAGATGTTGCTCGAAGCGCACCGAGGGCTCCTCGTGGGGTGG

CTGCTCACCGAGGCCCCCCTCAATCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCT
GACGAGTGGCTCCGGGGGGAGTTAGGGTTCCGGTTGGCGCTCTTCTACTGGGTCTAGTACAAACTCTGGA

TCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGG
AGTTGCACGGGCGGTACA (primer reverse)

AGTTGCACGGGCGGTACATGCACCGGTAGGTCCGGCACGACAGGGAGATGCGGAGGCCGTCCTGGTGGCC
Torna all'inizio della Pagina

FaFa86
Nuovo Arrivato



8 Messaggi

Inserito il - 23 gennaio 2010 : 18:46:23  Mostra Profilo  Visita l'Homepage di FaFa86 Invia a FaFa86 un Messaggio Privato  Rispondi Quotando
scusate se mi intrometto..... ma lo stesso esercizio che hai fatto proprio qui....se ci metti 3' e 5' davanti alle sequenze?
dovrebbe essere così?

5'-CCACCGCAGCGGACAGCGCCAAGTGAAGCCTCGCTTCCCCTCCGCGGCGACCAGGGCCCGAGCCGAGAGT
AGCAGTTGTAGCTACCCGCCCAGAAACTAGACACAATGTGCGACGAAGACGAGACCACCGCCCTCGTGTG
CGACAATGGCTCCGGCCTGGTGAAAGCCGGCTTCGCCGGGGATGACGCCCCTAGGGCCGTGTTCCCGTCC
ATCGTGGGCCGCCCCCGACACCAGGGCGTCATGGTCGGTATGGGTCAGAAAGATTCCTACGTGGGCGACG
AGGCTCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCACCAACTGGGA
TGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTTCGCGTGGCTCCCGAGGAGCACCCCACC
CTGCTCACCGAGGCCCCCCTCAATCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCT
TCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGG -3'

oppure prima 3' davanti e poi 5' alla fine?
cioè: chi è senso e chi è antisenso?
senso = codificante = 5'...........3' oppure 3'.........5'?
grazie mille!
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 23 gennaio 2010 : 20:17:22  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Le sequenze si leggono "sempre" da 5' a 3', quindi quella segnata è la sequenza codificante (o senso) (5'-3') mentre l'altra (quando ho messo il doppio filamento) è quella non codificante (o antisenso) (3'-5').
Quindi sì è come hai segnato tu:

5'-CCACCGCAGCGGACAGCGCCAAGTGAAGCCTCGCTTCCCCTCCGCGGCGACCAGGGCCCGAGCCGAGAGT
   AGCAGTTGTAGCTACCCGCCCAGAAACTAGACACAATGTGCGACGAAGACGAGACCACCGCCCTCGTGTG
   CGACAATGGCTCCGGCCTGGTGAAAGCCGGCTTCGCCGGGGATGACGCCCCTAGGGCCGTGTTCCCGTCC
   ATCGTGGGCCGCCCCCGACACCAGGGCGTCATGGTCGGTATGGGTCAGAAAGATTCCTACGTGGGCGACG
   AGGCTCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCACCAACTGGGA
   TGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTTCGCGTGGCTCCCGAGGAGCACCCCACC
   CTGCTCACCGAGGCCCCCCTCAATCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCT
   TCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGG -3'


e quella a doppio filamento (e con primer) sarebbe:

5'-CCACCGCAGCGGACAGCGCCAAGTGAAGCCTCGCTTCCCCTCCGCGGCGACCAGGGCCCGAGCCGAGAGT

5'-CCACCGCAGCGGACAGCGC-3' (primer forward)
3'-GGTGGCGTCGCCTGTCGCGGTTCACTTCGGAGCGAAGGGGAGGCGCCGCTGGTCCCGGGCTCGGCTCTCA

   AGCAGTTGTAGCTACCCGCCCAGAAACTAGACACAATGTGCGACGAAGACGAGACCACCGCCCTCGTGTG
   TCGTCAACATCGATGGGCGGGTCTTTGATCTGTGTTACACGCTGCTTCTGCTCTGGTGGCGGGAGCACAC

   CGACAATGGCTCCGGCCTGGTGAAAGCCGGCTTCGCCGGGGATGACGCCCCTAGGGCCGTGTTCCCGTCC
   GCTGTTACCGAGGCCGGACCACTTTCGGCCGAAGCGGCCCCTACTGCGGGGATCCCGGCACAAGGGCAGG

   ATCGTGGGCCGCCCCCGACACCAGGGCGTCATGGTCGGTATGGGTCAGAAAGATTCCTACGTGGGCGACG
   TAGCACCCGGCGGGGGCTGTGGTCCCGCAGTACCAGCCATACCCAGTCTTTCTAAGGATGCACCCGCTGC

   AGGCTCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCACCAACTGGGA
   TCCGAGTCTCGTTCTCTCCATAGGACTGGGACTTCATGGGATAGCTCGTGCCGTAGTAGTGGTTGACCCT

   TGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTTCGCGTGGCTCCCGAGGAGCACCCCACC
   ACTGTACCTCTTCTAGACCGTGGTGTGGAAGATGTTGCTCGAAGCGCACCGAGGGCTCCTCGTGGGGTGG

   CTGCTCACCGAGGCCCCCCTCAATCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCT
   GACGAGTGGCTCCGGGGGGAGTTAGGGTTCCGGTTGGCGCTCTTCTACTGGGTCTAGTACAAACTCTGGA

   TCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGG-3'
3'-AGTTGCACGGGCGGTACA-5' (primer reverse)

   AGTTGCACGGGCGGTACATGCACCGGTAGGTCCGGCACGACAGGGAGATGCGGAGGCCGTCCTGGTGGCC- 5'

Torna all'inizio della Pagina

FaFa86
Nuovo Arrivato



8 Messaggi

Inserito il - 24 gennaio 2010 : 11:59:24  Mostra Profilo  Visita l'Homepage di FaFa86 Invia a FaFa86 un Messaggio Privato  Rispondi Quotando
ma se io ti dicessi:
5'-CCACCGCAGCGGACAGCGCCAAGTGAAGCCTCGCTTCCCCTCCGCGGCGACCAGGGCCCGAGCCGAGAGT-3'
3'-GGTGGCGTCGCCTGTCGCGGTTCACTTCGGAGCGAAGGGGAGGCGCCGCTGGTCCCGGGCTCGGCTCTCA-5'



i primers alcuni amici mi hanno detto che sono :
forward: 5'-CCACCGCAGCGGACAGCGCC-3'
reverse: 5'-ACTCTCGGCTCGGGCCCTGG-3'

Ho chiesto a due persone diverse e entrambe me li hanno scritti così (indipendentemente)......

Grazie mille per le risposte
Torna all'inizio della Pagina

chick80
Moderatore

DNA

Città: Edinburgh


11491 Messaggi

Inserito il - 24 gennaio 2010 : 12:10:02  Mostra Profilo  Visita l'Homepage di chick80 Invia a chick80 un Messaggio Privato  Rispondi Quotando
E dov'è la differenza scusa?

Sei un nuovo arrivato?
Leggi il regolamento del forum e presentati qui

My photo portfolio (now on G+!)
Torna all'inizio della Pagina

FaFa86
Nuovo Arrivato



8 Messaggi

Inserito il - 24 gennaio 2010 : 14:16:33  Mostra Profilo  Visita l'Homepage di FaFa86 Invia a FaFa86 un Messaggio Privato  Rispondi Quotando
la sequenza l'ho cambiata leggermente.... vedi bene
Fai finta che la sequenza nostra adesso è questa che t'ho scritto.... dammi conferma che i primers sono quei due se puoi :)
grazie
Torna all'inizio della Pagina

chick80
Moderatore

DNA

Città: Edinburgh


11491 Messaggi

Inserito il - 24 gennaio 2010 : 14:39:54  Mostra Profilo  Visita l'Homepage di chick80 Invia a chick80 un Messaggio Privato  Rispondi Quotando
sì, quelli sono 2 primers che amplificherebbero quella sequenza

Sei un nuovo arrivato?
Leggi il regolamento del forum e presentati qui

My photo portfolio (now on G+!)
Torna all'inizio della Pagina

FaFa86
Nuovo Arrivato



8 Messaggi

Inserito il - 24 gennaio 2010 : 14:40:40  Mostra Profilo  Visita l'Homepage di FaFa86 Invia a FaFa86 un Messaggio Privato  Rispondi Quotando
grazie assai
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 24 gennaio 2010 : 14:54:52  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Nota che i primers per amplificare una sequenza non devono per forza essere all'estremità della sequenza (a meno che tu non debba amplificarla per forza tutta)

Quindi riprendendo il mio esempio (metto solo il reverse), puoi avere questo che avevo disegnato prima:
   TCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGG-3'
3'-AGTTGCACGGGCGGTACA-5' (primer reverse)

   AGTTGCACGGGCGGTACATGCACCGGTAGGTCCGGCACGACAGGGAGATGCGGAGGCCGTCCTGGTGGCC- 5'


Ma anche questo:
   TCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGG-3'
                                 (primer reverse)   3'-GAGGCCGTCCTGGTGGCC-5' 

   AGTTGCACGGGCGGTACATGCACCGGTAGGTCCGGCACGACAGGGAGATGCGGAGGCCGTCCTGGTGGCC- 5'


Sono entrambi primers validi (come ce ne possono essere molti altri su quella sequenza).
Torna all'inizio della Pagina

FaFa86
Nuovo Arrivato



8 Messaggi

Inserito il - 24 gennaio 2010 : 15:20:22  Mostra Profilo  Visita l'Homepage di FaFa86 Invia a FaFa86 un Messaggio Privato  Rispondi Quotando
ok!grazie mille ^_^ ora è chiaro ;)
Torna all'inizio della Pagina

stella 86
Nuovo Arrivato



35 Messaggi

Inserito il - 28 gennaio 2010 : 11:28:05  Mostra Profilo  Visita l'Homepage di stella 86 Invia a stella 86 un Messaggio Privato  Rispondi Quotando
invece il mio professore fa delle modifiche ai primer per far si che la temperatura di melting dei due primer siano tra 59 max 62 °C ...ed è li che mi sorgono tanti dubbi perche' nn ho capito come modificare la mia sequenza!!poi tipo dice che i primers nn devono terminare con C G ..mi aiutereste ?? vorrei un esempio pratico alla teoria del prof...GRAZIE !
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 28 gennaio 2010 : 13:53:37  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Beh ci stiamo girando un po' in torno!
È esattamente quello che dicevo qui: http://www.molecularlab.it/forum/topic.asp?TOPIC_ID=16312
leggiti bene le regole per il disegno dei primers che ti ho linkato!
Poi prendi una sequenza (ad es. quella che ho messo qui) e provi a disegnarti dei primers tenendo conto di quelle caratteristiche!

Io ho detto fin da subito che questo esempio era solo per avere un idea di "cosa" fossero i primer forward e reverse e do certo non sono i primer migliori, ma delle sequenze che ho scritto "assolutamente a caso".

Se il primer deve terminare con G o C basta che lo fai ternmira con G o C, non c'è molto da capire.
Riprendendo l'esempio di prima: il primer forward da questo punto di vista va bene:

5'-CCACCGCAGCGGACAGCGCCAAGTGAAGCCTCGCTTCCCCTCCGCGGCGACCAGGGCCCGAGCCGAGAGT

5'-CCACCGCAGCGGACAGCGC-3' (primer forward)
-3'-GGTGGCGTCGCCTGTCGCGGTTCACTTCGGAGCGAAGGGGAGGCGCCGCTGGTCCCGGGCTCGGCTCTCA
finisce con una C.

Il primer reverse invece non va bene:
   TCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGG-3'
3'-AGTTGCACGGGCGGTACA-5' (primer reverse)

   AGTTGCACGGGCGGTACATGCACCGGTAGGTCCGGCACGACAGGGAGATGCGGAGGCCGTCCTGGTGGCC- 5'
perchè finisce con una A, ma basta ad es togliere l'ultima base e finisce con una G!
   TCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGG-3'
 3'-GTTGCACGGGCGGTACA-5' (primer reverse)

   AGTTGCACGGGCGGTACATGCACCGGTAGGTCCGGCACGACAGGGAGATGCGGAGGCCGTCCTGGTGGCC- 5'

poi ti calcoli la Tm e controlli che vada bene, la lunghezza del primer... ecc...
Torna all'inizio della Pagina
  Discussione  

Quanto è utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-18 MolecularLab.it Torna all'inizio della Pagina