Forum

Nome Utente:
Password:
Riconoscimi automaticamente
 Tutti i Forum
 Laboratorio
 Bioinformatica e Biostatistica
 esercitazione di bioinformatica
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'è:

Aggiungi Tag Aggiungi i tag

Quanto è utile/interessante questa discussione:

Autore Discussione  

biologa2009
Nuovo Arrivato



4 Messaggi

Inserito il - 05 luglio 2010 : 11:58:13  Mostra Profilo  Visita l'Homepage di biologa2009 Invia a biologa2009 un Messaggio Privato  Rispondi Quotando
SALVE RAGAZZI, tra un pò dovrò sostenere l'esame di bioinformatica e, la prof ci ha assegnato un esercizio da svolgere, per fortuna su alcuni punti sn sicura ,ma su altri ho dei dubbi. PER FAVORE QUALCUNO AVREBBE VOGLIA DI SVOLGERLO IN MODO DA CONFRONTARMI? RINGRAZIO ANTICIPATAMENTE CHI SARà GENTILISSIMO/A AD AIUTARMI:
Data la sequenza:

>seq1


YAGTAGTAGAAGATGATTTAAGATTGCACCATGATACAG
ATGATGTAACATACCAAGTCTATGAGGAACAAGCAGTAT
ATGAACCTCTAGAAAATGATGTAGGGATAGAAATCACAG
ACCCTGAGGATTTTGCCAATCCTGTAGAAGATTCACAGG
TAATTGTAGAAGAAGTAAGCATTTTTCCTGTGGAAGAAC
AGCAGGAAGTACCACCAGATACTTAAAGRCTTCAAAAAGA



A) Determinare la sequenza complementare nella corretta direzione di lettura.


Tradurre in modo opportuno per ottenere:



B) i primi 10 codoni del frame di lettura 6. Si indichino chiaramente i codoni e gli amminoacidi corrispondenti.



C) Quante proline sono presenti sul frame di lettura 3 ?



D) Quale e’ il frame di lettura con minor numero di stop codons?



Si consideri la sequenza in banca dati nucleotidica con accession number:

XP_001082726


Discutere dettagliatamente i dati osservati ed indicare almeno le seguenti informazioni:



E) di che sequenza si tratta?

F) A quale organismo appartiene la sequenza?


G) Indicare se si tratta di una sequenza del genoma ( ), di mRNA ( ), di una “coding sequence” ( ) di una proteina o di altro ( ).

H) Quanto e’ lunga la sequenza?



I) Quale e’ la lunghezza del tratto nucleotidico codificante la proteine, se presente.



J) Quale e’ la lunghezza della 3’ UTR, se presente.



K) Quale e’ la lunghezza della 5’ UTR, se presente.



Si analizzi la sequenza seq1 con almeno uno dei Programmi del Pacchetto BLAST discussi durante il corso. Giustificare la scelta del programma.

Si discutano dettagliatamente i risultati piu’ significativi secondo quanto imparato al corso.

In particolare si risponda almeno alle seguenti richieste:

O) si definiscano gli accession number di almeno 5 sequenze subject con allineamento significativo e score distinto. Discutere i dati mostrati

P) Si indichino per ciascuno dei 4 allineamenti la rispettiva lunghezza, il numero di identita’, similarita’ e gap (se possibile). Discutere i risultati mostrati
Q) si indichi l'expect value per ciascuno dei 4 allineamenti

P.S: I PUNTI O,P E Q, nn sn riuscita a svolgerli

domi84
Moderatore

Smile3D

Città: Glasgow


1723 Messaggi

Inserito il - 05 luglio 2010 : 14:01:41  Mostra Profilo  Visita l'Homepage di domi84 Invia a domi84 un Messaggio Privato  Rispondi Quotando
Ciao e Benvenuta sul forum!
Qui non facciamo gli esercizi per gli altri, quindi posta i tuoi risultati e il metodo di svolgimento e noi ti diremo se sono sbagliati!

Il mio blog: http://domi84.blogspot.com/
Le foto che ho scattato...
Torna all'inizio della Pagina

biologa2009
Nuovo Arrivato



4 Messaggi

Inserito il - 05 luglio 2010 : 19:01:52  Mostra Profilo  Visita l'Homepage di biologa2009 Invia a biologa2009 un Messaggio Privato  Rispondi Quotando
cmq nn volevo che qualcuno svolgesse gli esercizi per me, sn solo insucura dei miei risultati... grazie per la comprensione
Ecco cm io ho svolto gli esercizi:
A)
reverse complement TCTTTTTGAAGYCTTTAAGTATCTGGTGGTACTTCCTGCTGTTCTTCCACAGGAAAAATGCTTACTTCTTCTACAATTACCTGTGAATCTTCTACAGGATTGGCAAAATCCTCAGGGTCTGTGATTTCTATCCCTACATCATTTTCTAGAGGTTCATATACTGCTTGTTCCTCATAGACTTGGTATGTTACATCATCTGTATCATGGTGCAATCTTAAATCATCTTCTACTACTR

Tradurre in modo opportuno per ottenere:

B)
5'3' Frame 1
agtatctggtggtacttcctgctgttcttc
S I W W Y F L L F F
5'3' Frame 2
agtatctggtggtacttcctgctgttcttc
V S G G T S C C S
5'3' Frame 3
agtatctggtggtacttcctgctgttcttc
Y L V V L P A V L
3'5' Frame 1
gaagaacagcaggaagtaccaccagatact
E E Q Q E V P P D T
3'5' Frame 2
gaagaacagcaggaagtaccaccagatact
K N S R K Y H Q I
3'5' Frame 3
gaagaacagcaggaagtaccaccagatact
R T A G S T T R Y

C)E’ presente una sola prolina (P)

D)La frame di lettura con il minor numero di codoni stop è la frame 1

E)Si tratta di un mRNA

F)Macaca Mulatta ( una scimmia )

G)Si tratta di una sequenza di un mRNA
H)La sequenza è formata da 69 aa ovvero 276 bp.

I)69..>276 questa nomenclatura significa da 69 a 276


J)non è presente

K)Da 1 a 68

gli ultimi punti nn mi sn chiari, qualcuno potrebbe dirmi almeno quale programma usare? io ho provato cn BLAST ma nn mi è riuscito Grazie
Torna all'inizio della Pagina

kORdA
Utente Attivo

newkORdA

Prov.: Milano
Città: Monza


1303 Messaggi

Inserito il - 06 luglio 2010 : 12:46:15  Mostra Profilo  Visita l'Homepage di kORdA  Clicca per vedere l'indirizzo MSN di kORdA Invia a kORdA un Messaggio Privato  Rispondi Quotando
Io ho provato con un paio di clic a fare un nucleotide BLAST semplice semplice (http://blast.ncbi.nlm.nih.gov).
Questo e' quello che ho ottenuto:



Le informazioni che cerchi sono tutte qui...

http://www.linkedin.com/in/dariocorrada
Torna all'inizio della Pagina

biologa2009
Nuovo Arrivato



4 Messaggi

Inserito il - 06 luglio 2010 : 20:31:24  Mostra Profilo  Visita l'Homepage di biologa2009 Invia a biologa2009 un Messaggio Privato  Rispondi Quotando
grazie
Torna all'inizio della Pagina
  Discussione  

Quanto è utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-18 MolecularLab.it Torna all'inizio della Pagina