Forum

Nome Utente:
Password:
Riconoscimi automaticamente
 Tutti i Forum
 Laboratorio
 Bioinformatica e Biostatistica
 problema di bioinformatica/uso strumenti informatici
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'è:

Aggiungi Tag Aggiungi i tag

Quanto è utile/interessante questa discussione:

Autore Discussione  

Simone82
Nuovo Arrivato



4 Messaggi

Inserito il - 14 marzo 2012 : 16:46:15  Mostra Profilo  Visita l'Homepage di Simone82 Invia a Simone82 un Messaggio Privato  Rispondi Quotando
Ciao ragazzi,
Devo cosegnare un lavoro entro 10 giorni e avrei bisogno del vostro aiuto.
Vi spiego cosa devo fare:

Sono stati prodotti 3 cDNA (usando RNA estratti da tessuti pancreatici) tramite fagi lambda. Il primo è di un tessuto sano mentre il 2 e 3 sono librerie generate da tessuti di pazienti che soffrono di tumore al pancreas.
I cloni sono stati "matchati" per ibridizazione e sequenziati.

Di seguito ci sono le sequenze che corrispondono al cDNA prodotti con fagi lamba:

LIBRERIA1/CONTROLLO:

CATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCA

LIBRERIA2/PAZIENTE1

CGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGTGGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGG


LIBRERIA3/PAZIENTE2

GTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTACGACCCCCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCA


Mi si chiede di

1) Individuare il gene/i codificato dalla sequenza.
Ho trovato che si tratta del gene p53 però l'analisi con NCBI BLAST mi da le 7 possibili isoforme. Posso capire qual'è l'isoforma che corrisponde esattamente alla mia sequenza?

2)Identificare il corretto reading frame per ciascuna sequenza.
A tal proposito mi chiedono di utilizzare come strumento informatico ExPASy.(e qui non so come cercare nel sito lo strumento esatto.
Inoltre devo, attraverso il sito multalin, comparare le sequenze aminoacidiche delle proteine identificate.

3) Devo progettare i primers per il gene/i identificato. I primers devono essere adatti per amplificare, clonare ed esprimere il gene.
Devo giustificare la scelta dei primers, e discutere un approccio sperimentale per clonare il gene con riferimento al vettore pGEX-4T-1 ed discutere altre potenziali strategie di clonaggio.

Sono piuttosto nei guai. Chiedo solidarietà.

Grazie in anticipo per l'aiuto.

Geeko
Utente

Ctenophor1.0

Città: Milano


1042 Messaggi

Inserito il - 14 marzo 2012 : 20:23:38  Mostra Profilo  Visita l'Homepage di Geeko Invia a Geeko un Messaggio Privato  Rispondi Quotando
Le sequenze che hai derivano da cDNA e sono porzioni relativamente corte del trascritto; se vai a fare un allineamento con BLAST di ogni tua sequenza trovi, come hai già detto, una corrispondenza (%identità) con p53, che è la stessa per ognuna delle 7 isoforme (per es. con la prima sequenza, quella del controllo, hai una %identità del 100% con tutte e 7 le isoforme). Significa che queste sequenze corrispondono ad una porzione del tuo trascritto che è la stessa per tutte le isoforme (cioè queste non differiscono tra loro per tale regione).
Quindi non credo si possa distinguere di quale isoforma si tratta.

Per trovare il corretto frame di letture io userei "Tanslate", un tool di ExPASy; copi la sequenza nucleotidica e ottieni la sua traduzione nei 6 possibili reading-frame e tra questi scegli quello col numero minore di codoni STOP. Poi io verificherei che sia quello giusto andando a fare un allineamento di questo con la proteina nel database.

Per il clonaggio non ho avuto tempo di pensarci XD

(cmq non ti fidare troppo...sono uno studente e non uso spesso questi tools)



Torna all'inizio della Pagina

Simone82
Nuovo Arrivato



4 Messaggi

Inserito il - 15 marzo 2012 : 17:23:28  Mostra Profilo  Visita l'Homepage di Simone82 Invia a Simone82 un Messaggio Privato  Rispondi Quotando
grazie geeko,

usando lo strumento che mi hai indicato ho trovato i reading frame e ho allineato le sequenze aminoacidiche con multaline.

A questo punto ho un problema ulteriore:

quando allineo le sequenze nucleotidiche del controllo con il paziente1 ottengo un allineameto diverso rispetto
a quando allineo la sequenza del paziente uno con BLAST. Infatti in questo caso mi aspettavo di trvare lo stesso
risultato del primo allineamento.

Torna all'inizio della Pagina

Geeko
Utente

Ctenophor1.0

Città: Milano


1042 Messaggi

Inserito il - 15 marzo 2012 : 18:06:40  Mostra Profilo  Visita l'Homepage di Geeko Invia a Geeko un Messaggio Privato  Rispondi Quotando
Credo tu li possa trovare diversi perché sono diversi gli algoritmi usati dai due programmi per eseguire l'allineamento.
Comunque sono diversi in che senso? Numero di GAP o cosa? Puoi postare gli screenshot che ottieni magari?


Torna all'inizio della Pagina

Selenocisteina
Nuovo Arrivato

lucy



64 Messaggi

Inserito il - 17 marzo 2012 : 09:31:58  Mostra Profilo  Visita l'Homepage di Selenocisteina Invia a Selenocisteina un Messaggio Privato  Rispondi Quotando
Penso che alla prima domanda si possa rispondere forse con l'UCSC genome browser (google per il link)...
Lì esiste un modo per mappare sul genoma umano il cDNA ottenuto, una volta mappato puoi confrontarlo con altri cDNA noti e vedere se la tua porzione è presente solo in uno di essi; se è così puoi guardare a che isoforma corrisponda il cDNA.
Per quanto riguarda i primer, ci sono diversi tool su internet per crearli partendo solo dalla sequenza (google)... per clonarlo in quel vettore io direi di guardare che siti per ER ci sono nel vettore (dalla mappa che dovresti avere o che trovi sicuramente su internet), cercare sempre con qualche tool apposito tutti i siti per ER nel tuo cDNA e sceglierne uno che c'è sul vettore ma non sul cDNA, quindi teoricamente basta aggiungere il sito di restrizione in coda ai primer. Se devi fare un clonaggio direzionale scegli due siti di restrizione (uno per lato). :)

In ogni caso, quoto il commento di Geeko in quanto all'affidabilità della mia risposta.
Torna all'inizio della Pagina

Simone82
Nuovo Arrivato



4 Messaggi

Inserito il - 17 marzo 2012 : 11:44:45  Mostra Profilo  Visita l'Homepage di Simone82 Invia a Simone82 un Messaggio Privato  Rispondi Quotando
grazie per l'aiuto

Ho individuato il CDS del gene che devo amplificare in quel vettore.

La sequenza che allego di seguito è quella del gene allungata a sinistra dello start codon
e a destra del codone di stop di trenta nucleotidi ciascuno.
Adesso devo progettare il forward ed il reverse primers considerando che devo inserire,
come diceva selenocisteina (grazie per l'aiuto)i siti di restrizione per clonare il gene
nel vettore. A tal proposito il reverse primer deve essere il complementare e reverse di
cio che leggo all'estremita3' del gene ma il forward lo devo modificare?

5'GGCAGCCAGACTGCCTTCCGGGTCACTGCC(start codon)ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTC
TGAGTCAGGAAACATTTTCAGACCTATGGAAACTACTTCCTGAAAACAACGTTCTGTCCCCCTTGCCGTC
CCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCA
GATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCCCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGG
CCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTA
CGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTC
AACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCG
GCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCC
CCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAAT
TTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTG
AGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAA
CCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTT
GAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGG
AGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCTCCCCA
GCCAAAGAAGAAACCACTGGATGGAGAATATTTCACCCTTCAGATCCGTGGGCGTGAGCGCTTCGAGATG
TTCCGAGAGCTGAATGAGGCCTTGGAACTCAAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGG


Spero di sentire notizie a proposito. Devo consegnare il lavoro qusto venerdì
CTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAAGAC
AGAAGGGCCTGACTCAGACTGA(stop codon)CATTCTCCACTTCTTGTTCCCCACTGACAG3'
Torna all'inizio della Pagina

Selenocisteina
Nuovo Arrivato

lucy



64 Messaggi

Inserito il - 17 marzo 2012 : 13:18:13  Mostra Profilo  Visita l'Homepage di Selenocisteina Invia a Selenocisteina un Messaggio Privato  Rispondi Quotando
In che senso modificare?
In teoria, siccome la polimerasi funziona leggendo in direzione 3' -> 5' e scrivendo in 5'->3', il primer per copiare il filamento della CDS (che è scritto in 5' -> 3') deve partire dalla fine di questo (dal suo 3', perché la polimerasi legge da qui), però deve essere messo sull'altro filamento (quindi la sequenza che devi scrivere deve essere complementare a quella al 3' del tuo gene). Questo è il primer reverse.
Mentre, per copiare l'altro filamento (non quello con la CDS) devi fare un primer uguale alla porzione in 5' del filamento con la CDS (primer forward).
Spiegato a parole è un po' incomprensibile, guardati questo disegno e prova a ridisegnartelo che sicurametnte capisci dsubito
http://www.scielo.br/img/revistas/bjm/v34n4/4a01f02.gif

Comunque, volendo fare un lavoro fatto bene credo che dovresti usare un tool per disegnar ei primer perché devi tenere conto anche delle temperature di annealing per calcolarne le lunghezze (credo),
se è un lavoro puramente teorico tuttavia non serve. Se fai i primer così a mano basta che copi la stessa sequenza delle due estremità (tenendo conto di quale filamento copia il primer),
e aggiungi alle due estremità 5' la sequenza per il sito di restrizione così:

[sequenza per ER] 5' primer forward 3'
[sequenza per ER] 5' primer reverse 3'

Ah, è LA cds, perché sarebbe la coding sequence ;)
Torna all'inizio della Pagina

Simone82
Nuovo Arrivato



4 Messaggi

Inserito il - 17 marzo 2012 : 14:15:22  Mostra Profilo  Visita l'Homepage di Simone82 Invia a Simone82 un Messaggio Privato  Rispondi Quotando
Sostanzialmente se dovessi usare un forward di questo tipo:

5' BamH1 sito di restrizione G/GATCC- 3 nucleotidi spaziatori(TAT)-GACTGCCTTCCGGGTCACTGCC-start codon

Dunque:

1)Il sito di restrizione scelto in funzione del vettore è BamH1; poichè non è complementare al CDS lo inserisco come frammento "libero"
nel senso che non appaia con niente.

2)Lascio uno spaziatore di 3 nucleotidi(TAT non so se questo deve legarsi alla sequenza) perchè BamH1 funziona meglio in questo modo e
a tal proposito chiedo conferma.

3)Inserisco la sequenza (uguale al CDS) che si appaierà al filamento singolo di DNA lunga 22 basi per consentire un "forte" appaiamento con il CDS.

Quindi ho un totale di 31 nucleotidi per il forward di cui 9 non appaiati. Poichè BamH1 taglia tra il 1° e il 2° nucleotide, ho una sequenza
di 30 basi che dovrebbe mantenere (chiedo conferma) il frame di lettrura corretto per la successiva espressione del gene attraverso una
proteina di fusione.

Si tratta di un lavoro teorico, tuttavia devo considerare T di melting ed aneling.

Se per il forward il mio ragionamento è corretto affronterò successivamente queste problematiche (sebbene già so che il numero di GC forse è un pò troppo alto).

grazie per l'aiuto
Torna all'inizio della Pagina

Selenocisteina
Nuovo Arrivato

lucy



64 Messaggi

Inserito il - 18 marzo 2012 : 12:22:18  Mostra Profilo  Visita l'Homepage di Selenocisteina Invia a Selenocisteina un Messaggio Privato  Rispondi Quotando
Citazione:
Messaggio inserito da Simone82
1)Il sito di restrizione scelto in funzione del vettore è BamH1; poichè non è complementare al CDS lo inserisco come frammento "libero"
nel senso che non appaia con niente.


Esattamente: visto che il primer viene sintetizzato per sintesi chimica puoi aggiungere ciò che vuoi (di dimensioni non troppo estese) alla sequenza, anche se non è presente in uno stampo.


Citazione:

2)Lascio uno spaziatore di 3 nucleotidi(TAT non so se questo deve legarsi alla sequenza) perchè BamH1 funziona meglio in questo modo e
a tal proposito chiedo conferma.


Su questo non ho idea perché non ho mai fatto un esperimento simile e non so, nella pratica, se questo tipo di cose vengano considerate o ignorate.

Citazione:

3)Inserisco la sequenza (uguale al CDS) che si appaierà al filamento singolo di DNA lunga 22 basi per consentire un "forte" appaiamento con il CDS.


Quanto debba essere lungo il primer dipende dalle temperature di annealing... devi trovare un modo per calcolarle e vedere come ti conviene farlo.

Citazione:

Quindi ho un totale di 31 nucleotidi per il forward di cui 9 non appaiati. Poichè BamH1 taglia tra il 1° e il 2° nucleotide, ho una sequenza di 30 basi che dovrebbe mantenere (chiedo conferma) il frame di lettrura corretto per la successiva espressione del gene attraverso una proteina di fusione.


Ma se il sito di restrizione è a monte della CDS non importa quanto sia lunga la parte "prima", perché tanto nel momento in cui il ribosoma inizia a tradurre cerca l'AUG ed è importante che solo da lì in poi la CDS venga rispettata! L'unica cosa alla quale devi badare è che con il sito di restrizione usato non ci sia troppo spazio tra la Shine-Dalgarno (che dovrebbe essere sul vettore mi pare, altrimenti devi inserirla nel primer!) e l'AUG.

Se però la stai mettendo in un vettore di espressione devi tenere conto che il clonaggio deve essere direzionale, quindi scegli un altro sito di restrizione che sul vettore deve venire dopo BamHI per il primer reverse!

In ogni caso ho qualche dubbio che quello che ho scritto (basato solo su conoscenze teoriche) sia del tutto vero, perciò prendilo cum grano salis, e ovviamente sono benvenute correzioni da utenti più esperti di laboratorio (io sono bioinfo quindi certe cose purtroppo non le vedo più da un pezzo :))
Torna all'inizio della Pagina

0barra1
Utente Senior

Monkey's facepalm

Città: Paris, VIIème arrondissement


3847 Messaggi

Inserito il - 20 marzo 2012 : 14:14:13  Mostra Profilo  Visita l'Homepage di 0barra1 Invia a 0barra1 un Messaggio Privato  Rispondi Quotando
Non so se qualcuno lo ha già detto e non ho voglia di leggere tutto :D

Ma non si dovrebbe mai mettere un sito di restrizione all'estremità del primer, altrimenti l'efficienza di taglio cala. Meglio fare:


(2 nucletotidi)-(sito di restrizione)-(sequenza che si appaia perfettamente al target)



Ovviamente leggendo da destra verso sinistra come dal 5' verso il 3'

So, forget Jesus. The stars died so that you could be here today.
A Universe From Nothing, Lawrence Krauss

Torna all'inizio della Pagina

roberta.s
Utente Junior

yeast

Città: Parigi


564 Messaggi

Inserito il - 20 marzo 2012 : 14:40:17  Mostra Profilo  Visita l'Homepage di roberta.s Invia a roberta.s un Messaggio Privato  Rispondi Quotando
Concordo con 0barra, anche se io uso sei nt alle estremità
Torna all'inizio della Pagina

0barra1
Utente Senior

Monkey's facepalm

Città: Paris, VIIème arrondissement


3847 Messaggi

Inserito il - 20 marzo 2012 : 14:43:12  Mostra Profilo  Visita l'Homepage di 0barra1 Invia a 0barra1 un Messaggio Privato  Rispondi Quotando
Effettivamente possono essere in numero variabile, entro certi limiti eh.
Nel mio lab ne uso 2, da altre parti son soliti inserirne 3, Roberta 6.

Ma la regola generale è quella.

So, forget Jesus. The stars died so that you could be here today.
A Universe From Nothing, Lawrence Krauss

Torna all'inizio della Pagina
  Discussione  

Quanto è utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-18 MolecularLab.it Torna all'inizio della Pagina