Forum

Nome Utente:
Password:
Riconoscimi automaticamente
 Tutti i Forum
 Laboratorio
 Tecniche
 siRNA design
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'è:

Aggiungi Tag Aggiungi i tag

Quanto è utile/interessante questa discussione:

Autore Discussione  

serena.89
Nuovo Arrivato



43 Messaggi

Inserito il - 03 luglio 2012 : 13:35:40  Mostra Profilo  Visita l'Homepage di serena.89 Invia a serena.89 un Messaggio Privato  Rispondi Quotando
Si considera una malattia causata dalla mutazione in un gene (K12) che provoca la sostituzione di una leucina con una Prolina, in posizione 132. ( sostituzione di una R con una C in posizione 395 della coding sequence di K12. Si vuole trovare un siRna capace di silenziare specificamente l'allele mutato. Vi riporto proprio una parte dell'articolo
" siRNAs (19+2 format; 19-nucleotide duplex with two 3' uracyl
nucleotide overhangs) were synthesized by MWG Biotech AG
(Ebersberg, Germany) to screen all possible target sequences
containing the Leu132Pro mutation, plus positive and negative
controls. This T >C point mutation occurs at position 395 in the
K12 coding sequence, numbering by convention where the
initiating ATG, = 1 and excluding the 5'UTR (c.395T> C).

The sense and antisense strands for the mutation-specific siRNA
reagent designated as K12-L132P-1 were 5'-AGA AAC UAU
GCA AAA UCC UU and 5'-GGA UUU UGC AUA GUU UCU
UU, respectively (mutant position underlined"

Ora vi metto pure tutte alcune sequenze che sono state designate:

K12
5'-TCTGGATCAGAAAAAGAAACTATGCAAAATCTTAATGATAGATTAGCTTCCTACCTGGATAAG-3'
K12 mutante
5'-TCTGGATCAGAAAAAGAAACTATGCAAAATCCTAATGATAGATTAGCTTCCTACCTGGATAAG-3'
CCT


K12-L132P-1_____________________AAGAAACUAUGCAAAAUCCUU
K12-L132P-2______________________AGAAACUAUGCAAAAUCCUUU
K12-L132P-3_______________________GAAACUAUGCAAAAUCCUAUU


Non capisco che bisogno c'è di fare tutte queste sequenze se loro già sanno la posizione della mutazione ( o forse nn la sanno?) Non ho nemmeno capito il criterio cn cui vengono formate queste sequenze..

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 03 luglio 2012 : 23:43:22  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Se citi un artcicolo sarebbe meglio se mettessi anche il riferimento (almeno chi vuole può anadarsi avedere l'originale). Mi raccomando il riferimento però, non allegare articoli al forum!

Il link all'articolo è questo:
Development of Allele-Specific Therapeutic siRNA in Meesmann Epithelial Corneal Dystrophy


Comunque per rispondere alla tua domanda, quando progetti una strategia di silenziamento genico non puoi fare un solo siRNA e sperare di avere tanta fortuna che funzioni, devi disegnare varie sequenze testarle tutte e trovare quella che funziona. Troverai che alcune funzioneranno molto bene, altre poco e alcune affatto.

Torna all'inizio della Pagina

serena.89
Nuovo Arrivato



43 Messaggi

Inserito il - 04 luglio 2012 : 23:36:40  Mostra Profilo  Visita l'Homepage di serena.89 Invia a serena.89 un Messaggio Privato  Rispondi Quotando
uh grazie, lo hai linkato tu ;)

Cmq perchè alcune funzionano meglio e altre peggio??? è questione di complementarietà? Inoltre perchè i siRna hanno sempre le due U finali?
Torna all'inizio della Pagina
  Discussione  

Quanto è utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-18 MolecularLab.it Torna all'inizio della Pagina