Forum

Nome Utente:
Password:
Riconoscimi automaticamente
 Tutti i Forum
 Laboratorio
 Genetica
 esercizo genetica importante!!!
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'è:

Aggiungi Tag Aggiungi i tag

Quanto è utile/interessante questa discussione:

Autore Discussione  

ilarip
Utente Junior

haci
Prov.: Bologna
Città: Bologna


432 Messaggi

Inserito il - 09 novembre 2007 : 20:14:11  Mostra Profilo  Visita l'Homepage di ilarip  Clicca per vedere l'indirizzo MSN di ilarip Invia a ilarip un Messaggio Privato  Rispondi Quotando
ciao a tutti oggi il prof ha dato da fare un stranissimo esercizio:
Data la sequenza CCCAGCACTTTGGGCGGCCAAAGTGGGCAGATCGCGTAAGGCCAGGATTTCAGACCAGCCTGGCCAAGAT
individuare 3 stringe di 10 nucleotidi che abbiano TEMPERATURA DI MELTING(tm)=60°

il mio primo pensiero è stato quello di utilizzare la formula della tm ma penso che sia sbagliato visto che nn mi viene data ne la concentrazione salina ne la % in gc
Secondo voi come si fa? se qualcuno lo sa mi potrebbe spiegare anche il procediamento?
ringrazio anticipatamente
ciao

Ho imparato.. .che le opportunità non vanno mai perse.
Quelle che lasci andare tu...le prende qualcun altro
Ho imparato...che è meglio dare consigli solo in due circostanze...
Quando sono richiesti e quando ne dipende la vita.


chick80
Moderatore

DNA

Città: Edinburgh


11491 Messaggi

Inserito il - 09 novembre 2007 : 23:43:46  Mostra Profilo  Visita l'Homepage di chick80 Invia a chick80 un Messaggio Privato  Rispondi Quotando
Beh, la %GC te la dà! Hai la sequenza!!!! :)
Per farti un esempio:

CCCAGCACTT è fatta da 10 nucleotidi di cui 6 sono C o G, quindi la %GC è 60% (=6/10)

Per come svolgere l'esercizio hai 2 possibilità:
1) provare a mano...
2) scriverti un piccolo script che prova in automatico tutte le possibili stringhe (cosa che consiglierei)

Per brevi sequenze potresti usare la formula approssimata:

Tm = 4*(GC)+2*(AT)

Ad es. per la sequenza di sopra avrai:
4*6+2*4=24+8=32

Il problema è che usando la formula approssimata non avrai mai una Tm>40 per una sequenza di 10 basi... quindi dovresti almeno avere la [] dei primer e del template per usare una formula più accurata.

Vedi anche:
http://en.wikipedia.org/wiki/DNA_melting

Sei un nuovo arrivato?
Leggi il regolamento del forum e presentati qui

My photo portfolio (now on G+!)
Torna all'inizio della Pagina

Gabriele
Utente

Prov.: Pisa
Città: Pisa


615 Messaggi

Inserito il - 10 novembre 2007 : 01:16:38  Mostra Profilo  Visita l'Homepage di Gabriele Invia a Gabriele un Messaggio Privato  Rispondi Quotando
Ma in che modo questo sarebbe un esercizio di genetica?

"Chi rinuncia alla libertà per la sicurezza, non merita né la libertà né la sicurezza. E finirà col perdere entrambe."
Torna all'inizio della Pagina

chick80
Moderatore

DNA

Città: Edinburgh


11491 Messaggi

Inserito il - 10 novembre 2007 : 03:35:01  Mostra Profilo  Visita l'Homepage di chick80 Invia a chick80 un Messaggio Privato  Rispondi Quotando
Io lo chiamerei di bioinformatica o al max di biologia molecolare in effetti...

Sei un nuovo arrivato?
Leggi il regolamento del forum e presentati qui

My photo portfolio (now on G+!)
Torna all'inizio della Pagina

Patrizio
Moderatore

mago

Città: Vancouver


1900 Messaggi

Inserito il - 10 novembre 2007 : 12:40:10  Mostra Profilo  Visita l'Homepage di Patrizio  Clicca per vedere l'indirizzo MSN di Patrizio Invia a Patrizio un Messaggio Privato  Rispondi Quotando
tra l altro ci sono anche altri 2 metodi per calcolare la tm... solo che forse in lab il piu' usato e' questo


Torna all'inizio della Pagina

ilarip
Utente Junior

haci

Prov.: Bologna
Città: Bologna


432 Messaggi

Inserito il - 10 novembre 2007 : 15:38:20  Mostra Profilo  Visita l'Homepage di ilarip  Clicca per vedere l'indirizzo MSN di ilarip Invia a ilarip un Messaggio Privato  Rispondi Quotando
allora ringrazio tutti per avermi aiutato però io nn co sonoancora saltata fuori
con la formula approssimativa come diceva click 80 nn ho trovato alcuna sequanza che abbia una tm di 60 provando invece con la formula normale:
81.5+16.6+0.41*(%gc)-675/10 sostituendo per ogni sequenza la %in gc nn trovo ugualmente alcuna sequenza che abbia una tm di 60
Che devo fare?
Mi è stato dato anche un altro esercizio:
sapendo che il cromosoma 1 umano pesa 247*10(6) basi
Qual'è il suo peso estratto da:
12500000spermatidi
" "linfociti
" " eritrociti
in questo esecizio sono messa ancora piùmale del primo nn ho propio idea da dove partire
grazie spero che qualcuno mi possa aiutare!!!!!!!!

Ho imparato.. .che le opportunità non vanno mai perse.
Quelle che lasci andare tu...le prende qualcun altro
Ho imparato...che è meglio dare consigli solo in due circostanze...
Quando sono richiesti e quando ne dipende la vita.


Torna all'inizio della Pagina

darkene
Utente Junior

occhi



291 Messaggi

Inserito il - 10 novembre 2007 : 15:48:51  Mostra Profilo  Visita l'Homepage di darkene Invia a darkene un Messaggio Privato  Rispondi Quotando
se per peso intende il numero di basi, allora l'esercizio è molto semplice: devi solo ricordare che gli spermatidi hanno assetto aploide (quindi un solo cromosoma 1), i linfociti sono diploidi, mentre gli eritrociti non hanno DNA. quindi:

247x10^6 x 12500000 per gli spermatidi;
(247x10^6 x 12500000)x2 per i linfociti;
0 per gli eritrociti
Torna all'inizio della Pagina

ilarip
Utente Junior

haci

Prov.: Bologna
Città: Bologna


432 Messaggi

Inserito il - 10 novembre 2007 : 15:52:00  Mostra Profilo  Visita l'Homepage di ilarip  Clicca per vedere l'indirizzo MSN di ilarip Invia a ilarip un Messaggio Privato  Rispondi Quotando
anche io ci ero arrivata all'nizio ma pensavo fosse troppo semplice!!!!!
cmq grazie...

Ho imparato.. .che le opportunità non vanno mai perse.
Quelle che lasci andare tu...le prende qualcun altro
Ho imparato...che è meglio dare consigli solo in due circostanze...
Quando sono richiesti e quando ne dipende la vita.


Torna all'inizio della Pagina

ilarip
Utente Junior

haci

Prov.: Bologna
Città: Bologna


432 Messaggi

Inserito il - 10 novembre 2007 : 16:06:56  Mostra Profilo  Visita l'Homepage di ilarip  Clicca per vedere l'indirizzo MSN di ilarip Invia a ilarip un Messaggio Privato  Rispondi Quotando
ma scusate se vi disturbo sempre...
negli eritociti è vero che nn hanno nucleo ma nn bisognerebbe considerare il dna mitocondriale?

Ho imparato.. .che le opportunità non vanno mai perse.
Quelle che lasci andare tu...le prende qualcun altro
Ho imparato...che è meglio dare consigli solo in due circostanze...
Quando sono richiesti e quando ne dipende la vita.


Torna all'inizio della Pagina

darkene
Utente Junior

occhi



291 Messaggi

Inserito il - 10 novembre 2007 : 20:13:39  Mostra Profilo  Visita l'Homepage di darkene Invia a darkene un Messaggio Privato  Rispondi Quotando
si, ma stiamo parlando di cromosoma 1, quindi quello nucleare. il DNA mitocondriale (mtDNA) è una sola molecola circolare, quindi diversa dai cromosomi. inoltre il discorso della "quantizzazione del peso" come dici tu non si può fare perchè il numero di molecole di mtDNA non è standard, molto variabile: ogni mitocondrio contiene diverse copie di mtDNA (molto variabile) e ogni cellula molti mitocondri.
Torna all'inizio della Pagina

ilarip
Utente Junior

haci

Prov.: Bologna
Città: Bologna


432 Messaggi

Inserito il - 10 novembre 2007 : 21:45:12  Mostra Profilo  Visita l'Homepage di ilarip  Clicca per vedere l'indirizzo MSN di ilarip Invia a ilarip un Messaggio Privato  Rispondi Quotando
ok cspito grazie.............
grazie a tutti per avermi aiutato scusate del disturbo....

Ho imparato.. .che le opportunità non vanno mai perse.
Quelle che lasci andare tu...le prende qualcun altro
Ho imparato...che è meglio dare consigli solo in due circostanze...
Quando sono richiesti e quando ne dipende la vita.


Torna all'inizio della Pagina
  Discussione  

Quanto è utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-18 MolecularLab.it Torna all'inizio della Pagina