Forum

Nome Utente:
Password:
Riconoscimi automaticamente
 Tutti i Forum
 Laboratorio
 Biochimica
 primers pcr
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'Ŕ:

Aggiungi Tag Aggiungi i tag

Quanto Ŕ utile/interessante questa discussione:

Autore Discussione  

marco86
Nuovo Arrivato

Prov.: Novara


6 Messaggi

Inserito il - 28 maggio 2008 : 10:25:11  Mostra Profilo  Visita l'Homepage di marco86 Invia a marco86 un Messaggio Privato  Rispondi Quotando
Devo disegnare una coppia di primers per amplificare una regione di 3000 bp la quale Ŕ compresa tra due siti di restrizione EcoRV
Il prodotto di pcr dovrÓ essere sottoclonato sfruttando nel vettore il sito di restrizione SmaI (blunt)

La sequenza Ŕ:

5'GGTTGATATCCACCTATGGAATATCTTG ..... ATTGCAGCCTGACCTGATATCACGGGAT 3'

Primer upstream???
Primer downstream???

mark86
  Discussione  

Quanto Ŕ utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-18 MolecularLab.it Torna all'inizio della Pagina