
Nome Utente:
Riconoscimi automaticamente
 Tutti i Forum
 Biologia Molecolare
 Protocollo di transfezione
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'è:

Tag   plasmid    transfection    DNA    clonaggio  Aggiungi Tag

Quanto è utile/interessante questa discussione:

Autore Discussione  

Nuovo Arrivato

Città: Pisa

5 Messaggi

Inserito il - 03 marzo 2015 : 09:37:04  Mostra Profilo  Visita l'Homepage di mandri01 Invia a mandri01 un Messaggio Privato  Rispondi Quotando
Ciao a tutti,

sono in cerca di un'anima (o anche più di una) gentilissima in grado di farmi comprendere la fattibilità di questo protocollo.
Purtroppo le mie conoscenze biologiche sono limitate alle basi per ora , quindi ho un attimo di difficoltà a comprendere il sottostante protocollo.
Qualche anima pia può darmi qualche indicazione sui principali step che lo compongono?

Plasmid Contructs pAAV-Cag-Chr2-GFP was digested using enzymes BsrGI and EcoRI (New England Biolabs, MA). 2A-Puro was amplified with forward primer (GGACGAGCTGTACAAGGAGGGCCGCGGCAGCCTGCTGACC) and reverse primer (ATTATCGATGAATTCTCAGGCACCGGGCTTGCGGGTCATGC) that added BsrGI and EcoRI sites on the ends. The amplified PCR product was subsequently digested with BsrGI and EcoRI and ligated with the digested pAAV-Cag-Chr2-GFP to form pAAV-CagChr2-GFP-2A-Puro. Cloning was verified by DNA sequencing.

Grazie per l'attenzione.



Città: Glasgow

1718 Messaggi

Inserito il - 03 marzo 2015 : 19:58:18  Mostra Profilo  Visita l'Homepage di domi84 Invia a domi84 un Messaggio Privato  Rispondi Quotando
E' stato preso questo plasmide:
ed è stato digerito con EcoRI e BsrG1. Questo ha aperto il plasmide e lasciato due estremità sticky. Grazie alla PCR è stato creato un gene 2A-Puro fiancheggiato dai siti di restrizione EcoRI e BsrG1. E' stata fatta la ligasi, quindi il gene è all'interno del plasmide. Il clonaggio è stato poi sequenziato per verificare che sia avvenuto correttamente. Cosa non ti è chiaro?

Il mio blog:
Le foto che ho scattato...
Torna all'inizio della Pagina



Città: Edinburgh

11491 Messaggi

Inserito il - 03 marzo 2015 : 20:15:09  Mostra Profilo  Visita l'Homepage di chick80 Invia a chick80 un Messaggio Privato  Rispondi Quotando
In pratica si tratta di aggiungere qualche microlitro di enzima in un apposito buffer, incubare per un po', fare un paio di PCR e di elettroforesi, poi mandare tutto ad una ditta che fa il sequenziamento. Niente di complesso, ma se vuoi rifarlo e non l'hai mai fatto consiglio di trovare qualcuno che ti possa far vedere praticamente cosa fare.

Sei un nuovo arrivato?
Leggi il regolamento del forum e presentati qui

My photo portfolio (now on G+!)
Torna all'inizio della Pagina



Città: Glasgow

1718 Messaggi

Inserito il - 03 marzo 2015 : 20:26:57  Mostra Profilo  Visita l'Homepage di domi84 Invia a domi84 un Messaggio Privato  Rispondi Quotando
Ho notato solo ora....perchè il titolo è "Protocollo di transfezione"???

Il mio blog:
Le foto che ho scattato...
Torna all'inizio della Pagina

Nuovo Arrivato

Città: Pisa

5 Messaggi

Inserito il - 16 aprile 2015 : 17:55:12  Mostra Profilo  Visita l'Homepage di mandri01 Invia a mandri01 un Messaggio Privato  Rispondi Quotando

scusate il ritardo della risposta ma non avevo messo le notifiche per le risposte e quindi pensavo che la questione fosse rimasta senza risposte.

Grazie innanzitutto per le risposte.
Il problema è che sono un ingegnere biomedico, non proprio un biologo o un biotecnologo, e conosco più o meno queste tecniche senza averle mai eseguite.
Stavo facendo qualche ricerca per fare in modo di introdurre questi plasmidi all'interno delle cellule in maniera soft, ovvero senza l'utilizzo di virus visto che non ne ho le competenze, e nessuno può farlo per me.
Premetto che possiedo le conoscenze per operare in un laboratorio di biologia, però non ho mai usato questi strumenti.

Negli articoli tendono sempre a riassumere sinteticamente i processi, e non essendo pratico delle ceose avevo difficoltà a capire. Comunque già adesso mi sono fatto un'idea di come agire.

l'ho chiamato protocollo di transfezione perché volevo informazioni su questo, essenzialmente :)

Torna all'inizio della Pagina

Quanto è utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a: © 2003-18 Torna all'inizio della Pagina