Forum

Nome Utente:
Password:
Riconoscimi automaticamente
 Tutti i Forum
 Laboratorio
 Biotecnologie
 Ligation-independent-cloning LIC
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'è:

Aggiungi Tag Aggiungi i tag

Quanto è utile/interessante questa discussione:

Autore Discussione  

terreno85
Utente Junior




235 Messaggi

Inserito il - 28 giugno 2009 : 16:00:35  Mostra Profilo  Visita l'Homepage di terreno85 Invia a terreno85 un Messaggio Privato  Rispondi Quotando
ciao a tutti ho due domande al quale non trovo risposta

1) dove posso tovare la matta del vettore di espressione pNIC-28-Bsa1
2) come si usa la tecnica ligation-independent-cloning LIC

Una teoria può esserre provata da un esperimento. Ma nessun percorso guida dall'esperimento alla nascita di una teoria

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 29 giugno 2009 : 00:20:33  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Sono troppo stanca anche per leggere, ma prova a guardarti questi:
Ligation Independent Cloning: Efficient Directional Cloning of PCR Products
http://sgc.ki.se/pdfs/Workshop2008/Molbio_Nilsson%202008.pdf (trovi Ligation Independent Cloning e la mappa di pNIC-28-BsaI)
mappa di pNIC-28-Bsa4 (che sarebbe pNIC-28-BsaI): http://www.sgc.ox.ac.uk/structures/MM/Vectors/pNIC28-Bsa4/pNIC28-Bsa4_Vector_sheet.pdf

Torna all'inizio della Pagina

terreno85
Utente Junior




235 Messaggi

Inserito il - 29 giugno 2009 : 14:14:13  Mostra Profilo  Visita l'Homepage di terreno85 Invia a terreno85 un Messaggio Privato  Rispondi Quotando
Vediamo se ci riesco con il tuo aiuto ... allora ho un vettore pNIC-28-Bsa1 che contiene il cDNA della proteina che sto studiando...Voglio trasferire qst cDNA in un pET43 1a(+) utilizzando il sito di restrizione Sma1.

in sintesi dovrei utilizzare una ligation-independent-cloning ma non è che mi è tanto chiara ....puoi aiutarmi

Una teoria può esserre provata da un esperimento. Ma nessun percorso guida dall'esperimento alla nascita di una teoria
Torna all'inizio della Pagina

terreno85
Utente Junior




235 Messaggi

Inserito il - 29 giugno 2009 : 17:56:46  Mostra Profilo  Visita l'Homepage di terreno85 Invia a terreno85 un Messaggio Privato  Rispondi Quotando
Cerco di spiegari meglio . Se date un'occhiata al vettore pNIC-28, lo ha gentilmente postato GFpina vedrete che per clonare un gene dice di trattalo con BsaI, e dopo con T4 DNA polimerasi in presenza di dGTP....

io mi chiedo ma essendoci due siti bsa1 (a 106 e a 2037) per quale motivo devo andare ad usare un LIC-cloning ( che non ho capito ??? ) , quando potrei semplicemente incubare il vettore con Bsa1 e permettere che il SacB si stacchi dal plasmide ???

Successivamente avrei bisogno di clonare il SacB in un vettore pET43. Seguendo il protocollo mi dice di trattalo con Sma1 che ha un solo sito di taglio (ccc ggg), magari poteri fare una PCR con inneschi analogni al sito di restrizione SacI sul frammento estratto da pNIC ...poi lo trasforma e mi faccio un miniprep per vedere se il plasmide contiene o meno l'inserto

vi chiedo pero di spiegarmi la LIC , sono curioso !!

Una teoria può esserre provata da un esperimento. Ma nessun percorso guida dall'esperimento alla nascita di una teoria
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 01 luglio 2009 : 17:22:12  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Scusa il ritardo, ma ti avevo linkato quello che avevo trovato, ma non l'avevo letto, poi sono stata un po' presa.
Comunque iniziamo dalla LIC (che comunque nel primo link mi sembra spiegata bene).
Lo scopo della LIC è fare un clonaggio senza utilizzare enzimi di restrizione e ligazione.
Il metodo su cui si basa la LIC è semplice si utilizza la T4 DNA polimerasi che ha sia attività esonucleasica 3'-5' che polimerasica 5'-3'.
Se è in assenza di nucleotidi prevale l'attività esonucleasica, se è disponibile un solo dNTP taglia tutti i nucleotidi ma non quello del nucleotide presente, quindi ad esempio se hai dATP e questa sequenza:
3' GTGCTCTCGATGTAGCTTGCTCTAGAGTACGTTAGCTTGGCTCGA 5'
taglierà fino alla prima A, quindi:
3' ---------ATGTAGCTTGCTCTAGAGTACGTTAGCTTGGCTCGA 5'

Tagli vettore e plasmide in questo modo in modo che si creino estremità complementari, queste sia appaieranno e una volta all'interno della cellula verranno legate covalentemente.
(per le figure vedi l'allegato)
Ora per rispondere alle tue domande:
Citazione:
io mi chiedo ma essendoci due siti bsa1 (a 106 e a 2037) per quale motivo devo andare ad usare un LIC-cloning ( che non ho capito ??? ) , quando potrei semplicemente incubare il vettore con Bsa1 e permettere che il SacB si stacchi dal plasmide ???

Infatti fai così!
Tagli con BSA I ed excidi SacB, poi tratti il vettore con T4 per tagliare altre basi e generare estremità compatibili con quelle del prodotto di PCR trattato!

Citazione:
Successivamente avrei bisogno di clonare il SacB in un vettore pET43. Seguendo il protocollo mi dice di trattalo con Sma1 che ha un solo sito di taglio (ccc ggg), magari poteri fare una PCR con inneschi analogni al sito di restrizione SacI sul frammento estratto da pNIC ...poi lo trasforma e mi faccio un miniprep per vedere se il plasmide contiene o meno l'inserto

ok qua mi sono persa!
Il vettore pET43 ha un sito di taglio per Sma I e qua ci siamo (ho controllato la mappa) il resto non l'ho capito... e SacI che c'entra???
Torna all'inizio della Pagina

terreno85
Utente Junior




235 Messaggi

Inserito il - 05 settembre 2009 : 18:18:11  Mostra Profilo  Visita l'Homepage di terreno85 Invia a terreno85 un Messaggio Privato  Rispondi Quotando
sorry è stato un errore di battitura volevo scrivere SmaI . Per cortesia potresti dirmi dove trovi sul web le sequenze dei vettori di espressione come per esempio quella di pNIC-28-Bsa4 ?? mi servirebbe conoscere tutti i siti di restrizione....ti ringrazio in anticipo

Una teoria può esserre provata da un esperimento. Ma nessun percorso guida dall'esperimento alla nascita di una teoria
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 05 settembre 2009 : 22:23:22  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Citazione:
Messaggio inserito da terreno85

Per cortesia potresti dirmi dove trovi sul web le sequenze dei vettori di espressione come per esempio quella di pNIC-28-Bsa4 ??

Goooooooooooogle!
In genere se sai la ditta che produce il vettore, cerchi sul sito della ditta. Altrimenti ci sono database di sequenza di vettori come: http://www.addgene.org/pgvec1 (che indicava Domi84 in questa discussione: http://www.molecularlab.it/forum/topic.asp?TOPIC_ID=10939)
non so se ce ne siano altre.
Altrimenti ti rimane solo di affidarti a google.
Sinceramente non ricordo benissimo, dato che è passato un po' di tempo, ma mi sembra che le uniche cose che avevo trovato su pNIC-28-Bsa4 fossero quelle che ho linkato.
Altrimenti trovi tutta la sequenza in genebank, per pNIC28-Bsa4 è questa: http://www.ncbi.nlm.nih.gov/nuccore/124015065
e ti fai la mappa di restrizione utilizzando programmi apposta o tools on line tipo: Restriction Mapper

Torna all'inizio della Pagina

terreno85
Utente Junior




235 Messaggi

Inserito il - 07 settembre 2009 : 13:49:48  Mostra Profilo  Visita l'Homepage di terreno85 Invia a terreno85 un Messaggio Privato  Rispondi Quotando
si però la sequenza su gene bank non è molto precisa !! perchè in pNIC-28 c'è un solo sito di restrizione per EcoRI a 2058 cb -GAATTC- cosa che non è presente nella sequenza di gene bank .

Una teoria può esserre provata da un esperimento. Ma nessun percorso guida dall'esperimento alla nascita di una teoria
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 07 settembre 2009 : 14:08:08  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Ho provato a fare un'analisi con Restriction Mapper della sequenza presente in gene bank, in realtà i siti di restrizione risultato spostati di 46bp rispetto a quelli segnati nella mappa (che ho linkato nel primo post), non so per quale motivo! Comunque la sequenza per EcoRI la trovi a 2105bp.
Torna all'inizio della Pagina

terreno85
Utente Junior




235 Messaggi

Inserito il - 07 settembre 2009 : 14:19:33  Mostra Profilo  Visita l'Homepage di terreno85 Invia a terreno85 un Messaggio Privato  Rispondi Quotando
vero ! l'ho fatta anche io ora ... un'altra cosa,come ben sai ricercare una sequenza di qst tipo 5'ggatggctgactcagaagctccc-3' sulla sequenza completa, non conoscendo la sua posizione è troppo impegnativo .
in gene bank c'è un tool che permette di fare ciò ?

Inoltre visto che il sito è stato molto interessate ho pensati di creare un account, il fatto è che mi richiede l'università di provenienza e il professore associato !!percio mi chiedevo prima di creare un account è necessario inf. ilprofessore ? grazie mille

Una teoria può esserre provata da un esperimento. Ma nessun percorso guida dall'esperimento alla nascita di una teoria
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 07 settembre 2009 : 16:37:29  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Citazione:
Messaggio inserito da terreno85

... un'altra cosa,come ben sai ricercare una sequenza di qst tipo 5'ggatggctgactcagaagctccc-3' sulla sequenza completa, non conoscendo la sua posizione è troppo impegnativo .
in gene bank c'è un tool che permette di fare ciò ?


Beh in genebank che io sappia no, a parte BLAST ma non lo trovo molto adatto.
Io utilizzo AnnHyb (se ne parlava qui) sia per cercare primer che per cercare pezzi di sequenza, il limite almeno per la versione vecchia che ho qua è 50 basi.
Poi ci sono comunque i vari programmi di allineamento di sequenze che possono servire allo scopo, uno buono è CLC Sequence Viewer, che ha anche molte altre features interessanti.


Citazione:
Messaggio inserito da terreno85

Inoltre visto che il sito è stato molto interessate ho pensati di creare un account, il fatto è che mi richiede l'università di provenienza e il professore associato !!percio mi chiedevo prima di creare un account è necessario inf. ilprofessore ? grazie mille


ma dove vorresti creare l'account??? Non ho capito, quindi non ho idea se sia necessario o meno.
Torna all'inizio della Pagina

terreno85
Utente Junior




235 Messaggi

Inserito il - 17 settembre 2009 : 18:45:39  Mostra Profilo  Visita l'Homepage di terreno85 Invia a terreno85 un Messaggio Privato  Rispondi Quotando
Stò diventando matto, non riesco proprio a capire come è stato possibile usare una PCR su pNIC-28-BsaI usando qst nucleotidi :

Sequenza primer up : 5'-GGATGGCTGACTCAGAAGCTCCC-3'
Sequenza primer T7 rew: 5'-GCAGCCGGATCTCAGTGG-3'

Ho usato CLC sequence viewer per allineare le sequenze...ma non ci sono !!!
o per meglio ci seno sono parti di qst sequenze, invece io so di per certo che è stato ampliicato un gene precedentemente clonato in pNIC-28-BsaI usando qst primer!! che si trovano al di fuori della sequenza del gene.

Vi chiedo la grande Cortesia di aiutarmi, adesso è diventata una questione di principio risolvere qst enigma....

Una teoria può esserre provata da un esperimento. Ma nessun percorso guida dall'esperimento alla nascita di una teoria
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 17 settembre 2009 : 21:38:10  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
mmm forse dovresti darci delle indicazioni in più!
In effetti ho provato sulla sequenza di pNIC28-Bsa4, presa da genebank e il reverse c'è, per l'esattezza da 4274-4283
ma il forward non l'ho trovato.
Però non ho capito bene il tuo discorso:
Citazione:
invece io so di per certo che è stato ampliicato un gene precedentemente clonato in pNIC-28-BsaI usando qst primer!! che si trovano al di fuori della sequenza del gene.

non può essere che un primer sia esterno e l'altro sia a cavallo tra il gene e il vettore?
Sai che gene è e dove è stato clonato? (in che punto), perchè in questo caso dovresti inserirti la sequenza del gene all'interno del vettore nel punto dove è stato inserito e poi cercare i primers.
Torna all'inizio della Pagina

terreno85
Utente Junior




235 Messaggi

Inserito il - 19 settembre 2009 : 14:28:40  Mostra Profilo  Visita l'Homepage di terreno85 Invia a terreno85 un Messaggio Privato  Rispondi Quotando
Bhe il gene specifica l'enzima cysteina sulfinic acid decarboxylase, cmq ho pensato anche io al fatto che l'altro primer poteva trovarsi fra plasmide e gene, il problema è che anche nella sequenza della proteina non trovo qst primer, non sò forse sbaglio qualche cosa con il programma.

Una teoria può esserre provata da un esperimento. Ma nessun percorso guida dall'esperimento alla nascita di una teoria
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Città: Milano


8398 Messaggi

Inserito il - 20 settembre 2009 : 01:18:28  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Beh bisognerebbe capire bene dove è inserito, ma se solo è a cavallo tra il vettore e del gene clonato, non trovi comunque la sequenza del primer nel gene, ne troveresti comunque solo una parte.
Torna all'inizio della Pagina
  Discussione  

Quanto è utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-18 MolecularLab.it Torna all'inizio della Pagina