Forum

Nome Utente:
Password:
Riconoscimi automaticamente
 Tutti i Forum
 Laboratorio
 Biologia Molecolare
 ENZIMI DI RESTRIZIONE
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'č:

Aggiungi Tag Aggiungi i tag

Quanto č utile/interessante questa discussione:

Autore Discussione  

cecinestpas
Nuovo Arrivato



1 Messaggi

Inserito il - 19 gennaio 2020 : 17:05:53  Mostra Profilo Invia a cecinestpas un Messaggio Privato  Rispondi Quotando
Buonasera, mi serve una manna dal cielo per passare l'esame di bio molecolare II. Vi allego alcuni esercizi dell'esercitazione che ancora non mi sono del tutto chiari. Potreste spiegarmi come si svolgono?


sapendo che BAMHI taglia in quest sito:
5'G/GATCC 3'
3'CCTAG/G 5'

(sono estremitā coesive)

scrivi la sequenza dei frammenti di DNA ottenuti dalla digestione di questo frammento con BAMHI

5' ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3'
3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5'

domi84
Moderatore

Smile3D

Cittā: Glasgow


1714 Messaggi

Inserito il - 21 gennaio 2020 : 19:39:50  Mostra Profilo  Visita l'Homepage di domi84 Invia a domi84 un Messaggio Privato  Rispondi Quotando
http://www.molecularlab.it/forum/topic.asp?TOPIC_ID=34851

Il mio blog: http://domi84.blogspot.com/
Le foto che ho scattato...
Torna all'inizio della Pagina
  Discussione  

Quanto č utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-18 MolecularLab.it Torna all'inizio della Pagina