Forum

Nome Utente:
Password:
Riconoscimi automaticamente
 Tutti i Forum
 Laboratorio
 Bioinformatica e Biostatistica
 Disegnare primers per un SNP
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'č:

Aggiungi Tag Aggiungi i tag

Quanto č utile/interessante questa discussione:

Autore Discussione  

Umbrina
Nuovo Arrivato



10 Messaggi

Inserito il - 18 ottobre 2010 : 23:55:06  Mostra Profilo  Visita l'Homepage di Umbrina Invia a Umbrina un Messaggio Privato  Rispondi Quotando
Salve a tutti
potreste aiutarmi devo disegnare dei primers con 2 sequenze rs che si trovano sul mio gene di interesse e deve servirmi come allelic discrimination mi potreste dire come fare o indicarmi qualche sito o protocollo da seguire? Premetto che non so neanche disegnare primers normali. Grazie infinitamente

Umbrina
Nuovo Arrivato



10 Messaggi

Inserito il - 19 ottobre 2010 : 10:19:36  Mostra Profilo  Visita l'Homepage di Umbrina Invia a Umbrina un Messaggio Privato  Rispondi Quotando
inserisco un rs vi prego aiutatemi da sola non riesco

rs68268251 [Bos taurus]
GATATTGTAAGTTCCTTAGATTGTTT[A/T]GAACTGAGAGATACTAATTTGCACA
Torna all'inizio della Pagina

dallolio_gm
Moderatore


Prov.: Bo!
Cittā: Barcelona/Bologna


2445 Messaggi

Inserito il - 19 ottobre 2010 : 13:53:05  Mostra Profilo  Visita l'Homepage di dallolio_gm  Clicca per vedere l'indirizzo MSN di dallolio_gm Invia a dallolio_gm un Messaggio Privato  Rispondi Quotando
Quello che tu chiami rs č uno SNP annotato nel database dbSNP di NCBI.

Per informazioni su come disegnare un primer in generale puoi cercare in questo forum, per esempio leggiti questo topic: http://www.molecularlab.it/forum/topic.asp?TOPIC_ID=1655

Per amplificare lo snp, credo che il tuo caso sia questo:
- http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=helpsnpfaq&part=Search.Searching_for_SNP_Primer_Sequence#Search.How_do_I_find_primer_sequence_in

Il mio blog di bioinformatics (inglese): BioinfoBlog
Sono un po' lento a rispondere, posso tardare anche qualche giorno... ma abbiate fede! :-)
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina

Cittā: Milano


8383 Messaggi

Inserito il - 19 ottobre 2010 : 14:36:36  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Devi disegnare uno dei 2 primers in cui l'ultima base (3') sarā quella dove č presente il polimorfismo, ovviamente ne disegni 2, ognuno specifico per un polimorfismo mentre l'altro primer lo disegni in una regione che sia comune ad entrambi in questo modo farai 2 PCR e otterrai l'amplificato in una o nell'altra a secondo di quale sia il polimorfismo.

Esempio:

    TTGTAAGTTCCTTAGATTGTTTA primer F1
    TTGTAAGTTCCTTAGATTGTTTT primer F2
GATATTGTAAGTTCCTTAGATTGTTT[A/T]GAACTGAGAGATACTAATTTGCACA----------------------------------
                                                                           NNNNNNNNNNNNNNNNNNN primer R


Il senso č questo, ovviamente poi devi controllare i primers, io li ho scritti un po' a caso, ma l'importante č che la base al 3' corrisponda a quella dove č presente il polimorfismo.
Torna all'inizio della Pagina
  Discussione  

Quanto č utile/interessante questa discussione:

 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-18 MolecularLab.it Torna all'inizio della Pagina