Forum

Nome Utente:
Password:
Riconoscimi automaticamente
Password Dimenticata?

 Tutti i Forum
 Laboratorio
 Bioinformatica e Biostatistica
 Primers:come disegnarli
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
I seguenti utenti stanno leggendo questo Forum Qui c'è:
Pagina Successiva

Tag   primer  Aggiungi Tag

Quanto è utile/interessante questa discussione:

Autore Discussione
Pagina: di 2

tato
Nuovo Arrivato

Prov.: Catanzaro
Città: catanzaro


16 Messaggi

Inserito il - 15 giugno 2006 : 08:20:05  Mostra Profilo  Visita l'Homepage di tato Invia a tato un Messaggio Privato  Rispondi Quotando
Colleghi Biotecnologi, buon giorno.
Tra di voi c'è qualcuno che può inserire, online, i protocolli per disegnare i primers?
Non conoscendo la procedura, sto impazzendo nella ricerca dei primers per TRK-A, p75 ed NGFR.
Volete darmi una mano?
Grazie 1000!!!!!!!!!!!!!!!!

dallolio_gm
Moderatore


Prov.: Bo!
Città: Barcelona/Bologna


2445 Messaggi

Inserito il - 15 giugno 2006 : 16:36:03  Mostra Profilo  Visita l'Homepage di dallolio_gm  Clicca per vedere l'indirizzo MSN di dallolio_gm Invia a dallolio_gm un Messaggio Privato  Rispondi Quotando
Non me ne intendo particolarmente, prova su questo wiki: http://openwetware.org/wiki/Designing_primers , oppure qui: http://www.mcb.uct.ac.za/pcroptim.htm

Un piccolo motore di ricerca per trovare software bioinformatici e' questo: http://tinyurl.com/l9cda (scusa se c'e' un po' di spam, salta i primi tre links)

Il mio blog di bioinformatics (inglese): BioinfoBlog
Sono un po' lento a rispondere, posso tardare anche qualche giorno... ma abbiate fede! :-)
Torna all'inizio della Pagina

chick80
Moderatore

DNA

Città: Edinburgh


11486 Messaggi

Inserito il - 16 giugno 2006 : 02:20:45  Mostra Profilo  Visita l'Homepage di chick80 Invia a chick80 un Messaggio Privato  Rispondi Quotando
Allora, in generale non è una cosa che si fa in cinque minuti se la vuoi fare bene... ti dico il mio approccio, poi ovviamente ognuno ha il suo metodo! Per fare un esempio prendiamo il gene TRK-A.

Suppongo tu voglia fare solo RT-PCR qualitativa (il gene c'è oppure non c'è), per PCR preparativa/real time l'approccio è lievemente differente.

1) Leggersi la letteratura a riguardo (salterò questo step ... )
2) Il gene per TRKA (tyrosine kinase receptor A) è chiamato NTRK1, come puoi vedere su Entrez Gene.
3) Cliccando sul link nella pagina linkata sopra arrivi qui dove trovi un sacco di info sul gene.
4) Andando su Entrez Nucleotide puoi cercare NTRK1 e trovi un sacco di entries.
5) Ora, non ho idea in che specie ti serva, nell'uomo ci sono molte varianti di splicing, quindi devi prendere quella che ti interessa, per semplicità prendo quella di ratto, che sembra non avere varianti di splicing. (NM_021589)
Nota che questo è l'mRNA
6) Ora, se guardi le "features" vedrai che il gene è di 2633 bp (gene 1..2633), e la coding sequence è 62..2461
In generale io prenderei una sequenza che cada nella CDS, anche perchè è meglio evitare di andare ad amplificare le estremità.
7) In alto scegli: display->FASTA e otterrai solo la sequenza di nucleotidi
8) Vai su Primer3 (http://frodo.wi.mit.edu/)
e incolla la sequenza in FASTA. In alto puoi selezionare RODENT come mispriming library, e controlla che siano selezionati "pick left primer" e "pick right primer" (non ti serve la probe).
9) puoi fare direttamente Pick Primers per vedere cosa ottieni, oppure settare un po' i parametri. Ad es. primer size, che di default è 18-27, con un ottimale di 20, la Tm (57-63, opt 60) e cosi' via. In generale i parametri di default vanno bene.
Leggi http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www_help.cgi per avere più info sui vari parametri.
10) Una volta fatto Pick Primers ti darà una scelta principale
LEFT PRIMER GTCTGGTGGGTCAGGGACTA
RIGHT PRIMER GGGTTGCTTTCCATAGGTGA

e sotto altre scelte alternative

Quella principale non sembra male (Tm dei due primer molto vicine e attorno a 60, 50-60% GC, amplificato di 215 bp).
11) Vai su NCBI BLAST e inserisci la sequenza dei primers (uno alla volta)
Come database puoi usare nr (non redundant) oppure scegliere est human, est mouse etc. a seconda del gene che stai guardando (non c'è rat, quindi usiamo nr).
Nelle opzioni usa come limiti Rattus Norvegicus, metti la word size a 7 e expect value a 1000, come suggerito qui.
12) Premi Blast! e poi Format
13) La scelta non è il massimo, visto che ci sono molti match con altri geni per entrambi i primers, anche se a prima vista sembra che i geni "estranei" siano diversi.
Ad ogni modo io a questo punto proverei con altri primers da primer3.
Se la fortuna non ti assiste potresti cominciare a fare uno studio più approfondito sulla proteina: trova quali sono i domini tipici della proteina, e cerca di fare primers in quella regione.

Sei un nuovo arrivato?
Leggi il regolamento del forum e presentati qui

My photo portfolio (now on G+!)
Torna all'inizio della Pagina

Saretta
Utente Junior

micros

Prov.: Roma
Città: Provincia di Roma


263 Messaggi

Inserito il - 17 giugno 2006 : 13:05:03  Mostra Profilo  Visita l'Homepage di Saretta Invia a Saretta un Messaggio Privato  Rispondi Quotando
Una domanda generica: Io devo fare una PCR ad un frammento di DNA. A livello teorico devo progettare i due primer al 5' e al 3' semplicemente complementari? Senza altre aggiunte? Esempio: sequenza -AATGGCTTAGCCAT-, quali sarebbero i due primer?
Torna all'inizio della Pagina

dallolio_gm
Moderatore


Prov.: Bo!
Città: Barcelona/Bologna


2445 Messaggi

Inserito il - 19 giugno 2006 : 10:08:26  Mostra Profilo  Visita l'Homepage di dallolio_gm  Clicca per vedere l'indirizzo MSN di dallolio_gm Invia a dallolio_gm un Messaggio Privato  Rispondi Quotando
Citazione:
Messaggio inserito da chick80
[...cut...]

questa e' una buona risposta, varrebbe la pena di ricopiarla nel wiki.

Citazione:
Una domanda generica: Io devo fare una PCR ad un frammento di DNA. A livello teorico devo progettare i due primer al 5' e al 3' semplicemente complementari? Senza altre aggiunte? Esempio: sequenza -AATGGCTTAGCCAT-, quali sarebbero i due primer?
aspetta, questa seq. mi sembra troppo corta per calcolare dei primer.

Il mio blog di bioinformatics (inglese): BioinfoBlog
Sono un po' lento a rispondere, posso tardare anche qualche giorno... ma abbiate fede! :-)
Torna all'inizio della Pagina

Saretta
Utente Junior

micros

Prov.: Roma
Città: Provincia di Roma


263 Messaggi

Inserito il - 19 giugno 2006 : 13:24:46  Mostra Profilo  Visita l'Homepage di Saretta Invia a Saretta un Messaggio Privato  Rispondi Quotando
Si perdonami, avevo un vuoto su alcuni esercizi sulla PCR ma credo di averlo colmanto, è sufficiente progettare primers di circa 15-20 nucleotidi complementari alle due estremità..almeno credo!
Torna all'inizio della Pagina

valia
Moderatore


Prov.: UK


1001 Messaggi

Inserito il - 19 giugno 2006 : 17:27:51  Mostra Profilo  Visita l'Homepage di valia  Clicca per vedere l'indirizzo MSN di valia Invia a valia un Messaggio Privato  Rispondi Quotando
Non complementari!
Quando li ordini il forward deve essere UGUALE alla sequenza, il reverse REVERSE COMPLEMENTARE!

Torna all'inizio della Pagina

Petemme
Nuovo Arrivato




93 Messaggi

Inserito il - 19 giugno 2006 : 20:04:09  Mostra Profilo  Visita l'Homepage di Petemme Invia a Petemme un Messaggio Privato  Rispondi Quotando
Grande! Oggi ho usato la tecnica descritta da chick80 per la prima volta
Torna all'inizio della Pagina

dallolio_gm
Moderatore


Prov.: Bo!
Città: Barcelona/Bologna


2445 Messaggi

Inserito il - 01 maggio 2008 : 10:24:23  Mostra Profilo  Visita l'Homepage di dallolio_gm  Clicca per vedere l'indirizzo MSN di dallolio_gm Invia a dallolio_gm un Messaggio Privato  Rispondi Quotando
Recentemente é stato postato un link al programma perlprimer (grazie all'utente dr. zoidberg).

Lo si può scaricare dall'indirizzo:
- http://perlprimer.sourceforge.net/

Mi sembra essere realizzato piuttosto bene, anche se la grafica é un po' antiquata.
E' multipiattaforma e gli utenti Debian/Ubuntu lo possono installare facilmente dai repository ufficiali, senza dover scaricare dal sito.

Il mio blog di bioinformatics (inglese): BioinfoBlog
Sono un po' lento a rispondere, posso tardare anche qualche giorno... ma abbiate fede! :-)
Torna all'inizio della Pagina

dr zoidberg
Nuovo Arrivato

zoidberg



21 Messaggi

Inserito il - 29 maggio 2008 : 14:14:05  Mostra Profilo  Visita l'Homepage di dr zoidberg Invia a dr zoidberg un Messaggio Privato  Rispondi Quotando
ringraziate linux ubuntu e tutti i software open source
io l'ho trovato grazie alla lista programmi di ubuntu...

«Vivi come se dovessi morire domani. Impara come se dovessi vivere per sempre.»

Gandhi
Torna all'inizio della Pagina

leptingo
Nuovo Arrivato

yogi

Prov.: Caserta
Città: SAN MARCO EV.


1 Messaggi

Inserito il - 31 maggio 2008 : 13:07:58  Mostra Profilo  Visita l'Homepage di leptingo  Clicca per vedere l'indirizzo MSN di leptingo Invia a leptingo un Messaggio Privato  Rispondi Quotando
salve a tutti. Io ho scaricato il programma per la ricerca dei primers "perlprimer" per la ricerca di un primer di circa 336 bp della regione 5' UTR dell'HCV ma ho difficoltà nell'ottenere un primer che mi copra l'intera regione di 341bp. infatti l'amplificato più lungo che mi da è di 277 bp. come faccio a far capire al programma che come range di amplificazione voglio tutta la regione? oppure sapete suggerirmi qualche altro programma che mi permette di ottenere quello che cerco? grazie infinite!!!!! kiss

KATIA
Torna all'inizio della Pagina

dr zoidberg
Nuovo Arrivato

zoidberg



21 Messaggi

Inserito il - 05 giugno 2008 : 18:20:50  Mostra Profilo  Visita l'Homepage di dr zoidberg Invia a dr zoidberg un Messaggio Privato  Rispondi Quotando
io in genere lo uso per primer in real time in questa funzione si può scegliere la lunghezza dell'amplificato puoi provare modificando i dati lì e vedere che cosa ne esce...
ciao
in bocca al lupo

«Vivi come se dovessi morire domani. Impara come se dovessi vivere per sempre.»

Gandhi
Torna all'inizio della Pagina

francavilla
Nuovo Arrivato



2 Messaggi

Inserito il - 28 luglio 2008 : 14:45:04  Mostra Profilo  Visita l'Homepage di francavilla Invia a francavilla un Messaggio Privato  Rispondi Quotando
grazie mille del consiglio, mi é stato molto utile
Torna all'inizio della Pagina

domi84
Moderatore

Smile3D

Città: Glasgow


1534 Messaggi

Inserito il - 18 marzo 2009 : 17:10:13  Mostra Profilo  Visita l'Homepage di domi84 Invia a domi84 un Messaggio Privato  Rispondi Quotando
Qui ho indicato un altro metodo per disegnare i primer...
http://mybioinformatica.wordpress.com/2009/03/17/disegnare-velocemente-primer-con-clc/

Il mio blog: http://domi84.blogspot.com/
Le foto che ho scattato...
Torna all'inizio della Pagina

kia35
Nuovo Arrivato

Prov.: Varese
Città: Barasso


15 Messaggi

Inserito il - 22 marzo 2009 : 15:41:27  Mostra Profilo  Visita l'Homepage di kia35 Invia a kia35 un Messaggio Privato  Rispondi Quotando
Ciao! io avrei il problema opposto..ho dei primer per il cDNA gia disegnati (li ho trovati in lab quindi so solo la sequenza) e vorrei sapere in quale regione della mia sequenza codificante cadono..ci sono dei programmi che mi possono aiutare?
Grazie 1000!
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina



8329 Messaggi

Inserito il - 22 marzo 2009 : 16:08:25  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Citazione:
Messaggio inserito da kia35

Ciao! io avrei il problema opposto..ho dei primer per il cDNA gia disegnati (li ho trovati in lab quindi so solo la sequenza) e vorrei sapere in quale regione della mia sequenza codificante cadono..ci sono dei programmi che mi possono aiutare?
Grazie 1000!

per quello guarda questa discussione: http://www.molecularlab.it/forum/topic.asp?TOPIC_ID=12402

Torna all'inizio della Pagina

Laracroftit
Nuovo Arrivato

arabidopsis

Città: Sassari


37 Messaggi

Inserito il - 07 aprile 2009 : 11:35:35  Mostra Profilo  Visita l'Homepage di Laracroftit  Clicca per vedere l'indirizzo MSN di Laracroftit Invia a Laracroftit un Messaggio Privato  Rispondi Quotando
Citazione:
Recentemente é stato postato un link al programma perlprimer (grazie all'utente dr. zoidberg).

Lo si può scaricare dall'indirizzo:
- http://perlprimer.sourceforge.net/

Mi sembra essere realizzato piuttosto bene, anche se la grafica é un po' antiquata.
E' multipiattaforma e gli utenti Debian/Ubuntu lo possono installare facilmente dai repository ufficiali, senza dover scaricare dal sito.


Ciao a tutti!
volevo sapere se il programma consigliato da dallolio va bene anche per disegnare primers per la rea-time PCR. E nel caso avete qualche programma da consigliarmi?magari uno semplice, poichè è la prima volta che disegno primers, ma affidabile!
Grazie mille!

"I want to know God's thoughts...
...the rest are details."
(Albert Einstein)
Torna all'inizio della Pagina

GFPina
Moderatore

GFPina



8329 Messaggi

Inserito il - 07 aprile 2009 : 12:44:48  Mostra Profilo  Visita l'Homepage di GFPina  Clicca per vedere l'indirizzo MSN di GFPina Invia a GFPina un Messaggio Privato  Rispondi Quotando
Beh secondo me da quando hanno fatto Primer Blast, gli altri programmi sono meno utilizzati.
In ogni caso ti consiglio di utilizzarlo per controllare che siano specifici per la tua sequenza.
Se devi disegnare primer per real-time esistono anche delle banche dati che contengono primer già testati e validati per real-time, da qualche parte c'è una discussione con i link.
(piccolo consiglio personale, anche se li scegli dalla banca dati CONTROLLALI!!! una volta mi hanno fatto un brutto scherzo queste banche dati)

In ogni caso non ci sono grosse differenze tra il disegno dei primers per real-time o PCR end point, a parte il fatto che i frammenti amplificati devono essere abbastanza corti, e ovviamente è importante che verifichi che i tuoi primers non facciano dimeri.

Torna all'inizio della Pagina

sr
Nuovo Arrivato



1 Messaggi

Inserito il - 13 aprile 2009 : 20:38:57  Mostra Profilo  Visita l'Homepage di sr Invia a sr un Messaggio Privato  Rispondi Quotando
salve ragazzi
spero che qualcuno possa aiutarmi!Ho un problema con Perlprimer, il software che molti di voi conosceranno per disegnare primers.Io purtroppo lo conosco da poco e non ne sono molto pratico.Comunque il mio problema è che non riesco ad importare in nessun modo la mia sequenza(oltre 1300bp) su cui dovrò fare i miei primer, prima di tutto perchè non mi importa il file fasta salvato come file di txt e provando a scaricarla con ensembl non riesce ad attacarsi al server e mi restituisce errore. Qualcuno ha un'idea su come possa risolvere questa cosa ed evitarmi di impazzire a scrivere le ATGCTAGCTA.....
vi ringrazio
ciao
Torna all'inizio della Pagina

eleanor
Nuovo Arrivato



26 Messaggi

Inserito il - 23 maggio 2010 : 17:22:35  Mostra Profilo  Visita l'Homepage di eleanor Invia a eleanor un Messaggio Privato  Rispondi Quotando
Salve ragazzi, mi sto cimentando per la prima volta nel disegnare dei primers per amplificazione di geni del virus Grapevine fan leaf virus. Prima però devo trovare su GenBank sequenze di questo virus e poi le sequenze più conservate e disegnare dei primers su di esse.
Qualcuno sa come si fa?
Grazie mille
Torna all'inizio della Pagina

Vanilla Sky
Utente Junior




204 Messaggi

Inserito il - 23 maggio 2010 : 19:40:07  Mostra Profilo  Visita l'Homepage di Vanilla Sky  Rispondi Quotando
Ciao, dunque per trovare le sequenze che cerchi devi andare sul sito di PubMed: http://www.ncbi.nlm.nih.gov/sites/entrez/
Troverai in alto a sinistra "Search" con accanto una tendina in cui dovrai selezionare "Nucleotide".
A questo punto digita nello spazio sotto "Grapevine fanleaf virus".
(Premetto che sono ignorante in ambito agrario, ma ho visto che in questo modo ti vengono fuori 385 risultati, davvero tanti!!Sai se ti devi concentrare su un gene specifico?Perchè ho visto che in alto PubMed riporta):
Citazione:
This search in Gene shows 3 results, including:
GFLVs1gp1 (Grapevine fanleaf virus): 253K polyprotein
GFLVs2gp1 (Grapevine fanleaf virus): polyprotein
GfvsRgp1 (Grapevine fanleaf virus satellite RNA): 39K product, P3


Per salvarti la sequenza nucleotidica di ogni risultato che ti si propone, clicca il nome della sequenza (che è sottolineata ed evidenziata in blu): si caricherà una finestra che include la notazione della sequenza. In alto a destra clicca su "Download" e seleziona "FASTA", in questo modo ti potrai salvare solamente la sequenza nucleotidica.
Dopo aver eseguito questo procedimento per tutte le sequenze che ti interessano, dovrai allinearti le sequenze per vedere le regioni conservate sulle quali disegnarti i primer.
So che solitamente si usa BioEdit (è un programma gratuito che si può scaricare).
A questo punto non so come funzioni esattamente,perchè avendo un macintosh uso un altro programma..sorry!
Per disegnare i primer basta guardare le precedenti discussioni.
Spero di esserti stata un pò d'aiuto!


Torna all'inizio della Pagina

eleanor
Nuovo Arrivato



26 Messaggi

Inserito il - 23 maggio 2010 : 22:00:05  Mostra Profilo  Visita l'Homepage di eleanor Invia a eleanor un Messaggio Privato  Rispondi Quotando
Grazie......almeno ora so come procedere! Hai ragione i risultati sono tanti e purtroppo non so ancora su quale gene concentrarmi (di regola dovrei capire io quale gene considerare) ma domani chiederò meglio al prof!!
Se sono ancora in crisi mi farò viva!!!
Torna all'inizio della Pagina

SELE480840
Nuovo Arrivato



5 Messaggi

Inserito il - 07 giugno 2010 : 12:38:46  Mostra Profilo  Visita l'Homepage di SELE480840 Invia a SELE480840 un Messaggio Privato  Rispondi Quotando
ciao ragazzi...è la prima volta che scrivo...e sinceramente nn so se qst msg arriverà -.-' vorrei porvi un quesito....se io volessi mutare un aa in una sequenza proteica come faccio a disegnare un primer che rechi l'alterazione nucleotidica desiderata nella sequenza genica'??? grazie
Torna all'inizio della Pagina

Giulietta_BCM
Nuovo Arrivato



6 Messaggi

Inserito il - 20 agosto 2010 : 11:16:27  Mostra Profilo  Visita l'Homepage di Giulietta_BCM Invia a Giulietta_BCM un Messaggio Privato  Rispondi Quotando
Salve a tutti !! sto lavorando con il gene DEK-CAN e vorrei fare una long range PCR ma sto impazzendo con la ricerca dei primers! i programmi che avete citato sopra come Primer blast o perlprimer sono adatti anche per la long o ci sono programmi più adatti a questo tipo di PCR ? grazie a tutti
Torna all'inizio della Pagina

Aldolo
Nuovo Arrivato



3 Messaggi

Inserito il - 31 gennaio 2011 : 19:51:19  Mostra Profilo  Visita l'Homepage di Aldolo Invia a Aldolo un Messaggio Privato  Rispondi Quotando
Ciao ragazzi!!!sono nuovo in questo forum!!ecco ho qualche domanda...e spero mi potrete aiutare.Mercoledi ho l'esame di biologia molecolare...ma ho ancora qualche dubbio!!!queste sono alcune domande di esame:

1)Se tratto il platano con ozono, come faccio a vedere se anche in platano viene attivato il gene SOD?

2)Differenze tra colony screening e colony screening pcr?

3)Border primer quando vengono utilizzati??
Grazie mille raga PS sn disperato
Torna all'inizio della Pagina

Elis
Nuovo Arrivato

Città: To


18 Messaggi

Inserito il - 14 luglio 2011 : 21:39:53  Mostra Profilo  Visita l'Homepage di Elis Invia a Elis un Messaggio Privato  Rispondi Quotando
Ciao a tutti! esiste un tool su internet dove posso inserire FACILMENTE diverse coppie di primer e vedere se formano primer-dimer?

What does a fish know about the water in which it swims all its life? (A. Einstein)
Torna all'inizio della Pagina
Pagina: di 2 Discussione  

Quanto è utile/interessante questa discussione:

Pagina Successiva
 Nuova Discussione  Nuovo Sondaggio Nuovo Sondaggio
 Rispondi Aggiungi ai Preferiti Aggiungi ai Preferiti
Cerca nelle discussioni
Vai a:
MolecularLab.it © 2003-14 MolecularLab.it Torna all'inizio della Pagina